ID: 952181989

View in Genome Browser
Species Human (GRCh38)
Location 3:30926609-30926631
Sequence ATCTCTTAGCTAATGGTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952181985_952181989 16 Left 952181985 3:30926570-30926592 CCTACAGAACTTCAAAGTTCTAG No data
Right 952181989 3:30926609-30926631 ATCTCTTAGCTAATGGTGTTTGG No data
952181984_952181989 19 Left 952181984 3:30926567-30926589 CCACCTACAGAACTTCAAAGTTC No data
Right 952181989 3:30926609-30926631 ATCTCTTAGCTAATGGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952181989 Original CRISPR ATCTCTTAGCTAATGGTGTT TGG Intergenic
No off target data available for this crispr