ID: 952183608

View in Genome Browser
Species Human (GRCh38)
Location 3:30944978-30945000
Sequence GGGGTGAATTTGGAGCTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952183608_952183617 4 Left 952183608 3:30944978-30945000 CCTCTCAGCTCCAAATTCACCCC No data
Right 952183617 3:30945005-30945027 CATGCTCTGTGATAAGGGAGGGG No data
952183608_952183615 2 Left 952183608 3:30944978-30945000 CCTCTCAGCTCCAAATTCACCCC No data
Right 952183615 3:30945003-30945025 TGCATGCTCTGTGATAAGGGAGG No data
952183608_952183616 3 Left 952183608 3:30944978-30945000 CCTCTCAGCTCCAAATTCACCCC No data
Right 952183616 3:30945004-30945026 GCATGCTCTGTGATAAGGGAGGG No data
952183608_952183614 -1 Left 952183608 3:30944978-30945000 CCTCTCAGCTCCAAATTCACCCC No data
Right 952183614 3:30945000-30945022 CTTTGCATGCTCTGTGATAAGGG No data
952183608_952183618 5 Left 952183608 3:30944978-30945000 CCTCTCAGCTCCAAATTCACCCC No data
Right 952183618 3:30945006-30945028 ATGCTCTGTGATAAGGGAGGGGG No data
952183608_952183613 -2 Left 952183608 3:30944978-30945000 CCTCTCAGCTCCAAATTCACCCC No data
Right 952183613 3:30944999-30945021 CCTTTGCATGCTCTGTGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952183608 Original CRISPR GGGGTGAATTTGGAGCTGAG AGG (reversed) Intergenic
No off target data available for this crispr