ID: 952189609

View in Genome Browser
Species Human (GRCh38)
Location 3:31008860-31008882
Sequence ATGCACTTACAGCTGAGTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952189609_952189613 12 Left 952189609 3:31008860-31008882 CCCCTACTCAGCTGTAAGTGCAT No data
Right 952189613 3:31008895-31008917 CACCTCCCTTCTTGTATAACTGG No data
952189609_952189617 29 Left 952189609 3:31008860-31008882 CCCCTACTCAGCTGTAAGTGCAT No data
Right 952189617 3:31008912-31008934 AACTGGTAAAGCAAATGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952189609 Original CRISPR ATGCACTTACAGCTGAGTAG GGG (reversed) Intergenic
No off target data available for this crispr