ID: 952190109

View in Genome Browser
Species Human (GRCh38)
Location 3:31014157-31014179
Sequence CCTCATGGACTGCAGTTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952190109_952190115 3 Left 952190109 3:31014157-31014179 CCATTTAACTGCAGTCCATGAGG No data
Right 952190115 3:31014183-31014205 CCATGCTAGCAACTCAGCTAGGG No data
952190109_952190113 2 Left 952190109 3:31014157-31014179 CCATTTAACTGCAGTCCATGAGG No data
Right 952190113 3:31014182-31014204 TCCATGCTAGCAACTCAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952190109 Original CRISPR CCTCATGGACTGCAGTTAAA TGG (reversed) Intergenic
No off target data available for this crispr