ID: 952193687

View in Genome Browser
Species Human (GRCh38)
Location 3:31050063-31050085
Sequence GTGTACATCTTGGGGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952193678_952193687 25 Left 952193678 3:31050015-31050037 CCTTCTTTGCCATATGGGGTAAC No data
Right 952193687 3:31050063-31050085 GTGTACATCTTGGGGAAGGAAGG No data
952193679_952193687 16 Left 952193679 3:31050024-31050046 CCATATGGGGTAACAATCACAGG No data
Right 952193687 3:31050063-31050085 GTGTACATCTTGGGGAAGGAAGG No data
952193677_952193687 26 Left 952193677 3:31050014-31050036 CCCTTCTTTGCCATATGGGGTAA No data
Right 952193687 3:31050063-31050085 GTGTACATCTTGGGGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952193687 Original CRISPR GTGTACATCTTGGGGAAGGA AGG Intergenic
No off target data available for this crispr