ID: 952195971

View in Genome Browser
Species Human (GRCh38)
Location 3:31075716-31075738
Sequence CTGTGACCAAAGTCTCCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952195971_952195977 30 Left 952195971 3:31075716-31075738 CCTGTGGGAGACTTTGGTCACAG No data
Right 952195977 3:31075769-31075791 GTCATCTCTGATGAAATCTGAGG No data
952195971_952195973 8 Left 952195971 3:31075716-31075738 CCTGTGGGAGACTTTGGTCACAG No data
Right 952195973 3:31075747-31075769 ACTGAGAAGTTCCAGCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952195971 Original CRISPR CTGTGACCAAAGTCTCCCAC AGG (reversed) Intergenic
No off target data available for this crispr