ID: 952196907

View in Genome Browser
Species Human (GRCh38)
Location 3:31085372-31085394
Sequence TGAGACACGCTGAAAGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952196906_952196907 6 Left 952196906 3:31085343-31085365 CCGGTAAAATAAATCAGGAGGGT No data
Right 952196907 3:31085372-31085394 TGAGACACGCTGAAAGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952196907 Original CRISPR TGAGACACGCTGAAAGTGAA AGG Intergenic
No off target data available for this crispr