ID: 952199335

View in Genome Browser
Species Human (GRCh38)
Location 3:31110271-31110293
Sequence CAGGGTAAGCAGGGGTATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952199324_952199335 10 Left 952199324 3:31110238-31110260 CCCCTGCATGCCTGTGCAGGATA No data
Right 952199335 3:31110271-31110293 CAGGGTAAGCAGGGGTATGCTGG No data
952199325_952199335 9 Left 952199325 3:31110239-31110261 CCCTGCATGCCTGTGCAGGATAA No data
Right 952199335 3:31110271-31110293 CAGGGTAAGCAGGGGTATGCTGG No data
952199326_952199335 8 Left 952199326 3:31110240-31110262 CCTGCATGCCTGTGCAGGATAAG No data
Right 952199335 3:31110271-31110293 CAGGGTAAGCAGGGGTATGCTGG No data
952199328_952199335 0 Left 952199328 3:31110248-31110270 CCTGTGCAGGATAAGGTTTCCTT No data
Right 952199335 3:31110271-31110293 CAGGGTAAGCAGGGGTATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952199335 Original CRISPR CAGGGTAAGCAGGGGTATGC TGG Intergenic
No off target data available for this crispr