ID: 952202421

View in Genome Browser
Species Human (GRCh38)
Location 3:31144828-31144850
Sequence CAGGGAAAACAGAACTAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952202421_952202424 -6 Left 952202421 3:31144828-31144850 CCCTCTTAGTTCTGTTTTCCCTG No data
Right 952202424 3:31144845-31144867 TCCCTGTATTCTATAGGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952202421 Original CRISPR CAGGGAAAACAGAACTAAGA GGG (reversed) Intergenic
No off target data available for this crispr