ID: 952206577

View in Genome Browser
Species Human (GRCh38)
Location 3:31186370-31186392
Sequence ACATAAAGACTATAGTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952206577_952206584 9 Left 952206577 3:31186370-31186392 CCCACCAACTATAGTCTTTATGT No data
Right 952206584 3:31186402-31186424 ATAGAGAGAGCTGGTGTGGTGGG No data
952206577_952206585 10 Left 952206577 3:31186370-31186392 CCCACCAACTATAGTCTTTATGT No data
Right 952206585 3:31186403-31186425 TAGAGAGAGCTGGTGTGGTGGGG No data
952206577_952206582 5 Left 952206577 3:31186370-31186392 CCCACCAACTATAGTCTTTATGT No data
Right 952206582 3:31186398-31186420 AAGAATAGAGAGAGCTGGTGTGG No data
952206577_952206583 8 Left 952206577 3:31186370-31186392 CCCACCAACTATAGTCTTTATGT No data
Right 952206583 3:31186401-31186423 AATAGAGAGAGCTGGTGTGGTGG No data
952206577_952206581 0 Left 952206577 3:31186370-31186392 CCCACCAACTATAGTCTTTATGT No data
Right 952206581 3:31186393-31186415 CCTTAAAGAATAGAGAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952206577 Original CRISPR ACATAAAGACTATAGTTGGT GGG (reversed) Intergenic
No off target data available for this crispr