ID: 952207830 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:31198198-31198220 |
| Sequence | ATACAGTGATAGGTGGGGCA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 952207830_952207840 | 23 | Left | 952207830 | 3:31198198-31198220 | CCATGCCCCACCTATCACTGTAT | No data | ||
| Right | 952207840 | 3:31198244-31198266 | TGGCTTCCCCAAAGTACTGTTGG | No data | ||||
| 952207830_952207837 | 3 | Left | 952207830 | 3:31198198-31198220 | CCATGCCCCACCTATCACTGTAT | No data | ||
| Right | 952207837 | 3:31198224-31198246 | CCAACCAGTCTGATGCCATATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 952207830 | Original CRISPR | ATACAGTGATAGGTGGGGCA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||