ID: 952207830

View in Genome Browser
Species Human (GRCh38)
Location 3:31198198-31198220
Sequence ATACAGTGATAGGTGGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952207830_952207840 23 Left 952207830 3:31198198-31198220 CCATGCCCCACCTATCACTGTAT No data
Right 952207840 3:31198244-31198266 TGGCTTCCCCAAAGTACTGTTGG No data
952207830_952207837 3 Left 952207830 3:31198198-31198220 CCATGCCCCACCTATCACTGTAT No data
Right 952207837 3:31198224-31198246 CCAACCAGTCTGATGCCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952207830 Original CRISPR ATACAGTGATAGGTGGGGCA TGG (reversed) Intergenic
No off target data available for this crispr