ID: 952210597

View in Genome Browser
Species Human (GRCh38)
Location 3:31225796-31225818
Sequence CTGTGTGGCAGCAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952210597_952210603 12 Left 952210597 3:31225796-31225818 CCCTCTTCCCTGCTGCCACACAG No data
Right 952210603 3:31225831-31225853 CCACTTCCCCCTCTTTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952210597 Original CRISPR CTGTGTGGCAGCAGGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr