ID: 952212337 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:31240870-31240892 |
| Sequence | CTTTCAAGGCTGAAAATGAA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 952212332_952212337 | 15 | Left | 952212332 | 3:31240832-31240854 | CCAACATCAACCAGTGTGAAGTG | No data | ||
| Right | 952212337 | 3:31240870-31240892 | CTTTCAAGGCTGAAAATGAAGGG | No data | ||||
| 952212334_952212337 | 5 | Left | 952212334 | 3:31240842-31240864 | CCAGTGTGAAGTGAGGAAAATCT | No data | ||
| Right | 952212337 | 3:31240870-31240892 | CTTTCAAGGCTGAAAATGAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 952212337 | Original CRISPR | CTTTCAAGGCTGAAAATGAA GGG | Intergenic | ||
| No off target data available for this crispr | |||||