ID: 952212337

View in Genome Browser
Species Human (GRCh38)
Location 3:31240870-31240892
Sequence CTTTCAAGGCTGAAAATGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952212332_952212337 15 Left 952212332 3:31240832-31240854 CCAACATCAACCAGTGTGAAGTG No data
Right 952212337 3:31240870-31240892 CTTTCAAGGCTGAAAATGAAGGG No data
952212334_952212337 5 Left 952212334 3:31240842-31240864 CCAGTGTGAAGTGAGGAAAATCT No data
Right 952212337 3:31240870-31240892 CTTTCAAGGCTGAAAATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952212337 Original CRISPR CTTTCAAGGCTGAAAATGAA GGG Intergenic
No off target data available for this crispr