ID: 952212515

View in Genome Browser
Species Human (GRCh38)
Location 3:31242495-31242517
Sequence CTGTTTGACCATATTGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952212515_952212518 0 Left 952212515 3:31242495-31242517 CCCTTCTCAATATGGTCAAACAG No data
Right 952212518 3:31242518-31242540 ACTGGCTGAAAGCAAACATTTGG No data
952212515_952212520 27 Left 952212515 3:31242495-31242517 CCCTTCTCAATATGGTCAAACAG No data
Right 952212520 3:31242545-31242567 AACATTTCCTTCTATCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952212515 Original CRISPR CTGTTTGACCATATTGAGAA GGG (reversed) Intergenic
No off target data available for this crispr