ID: 952213328

View in Genome Browser
Species Human (GRCh38)
Location 3:31251330-31251352
Sequence GAGGATAAAGAGAAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2725
Summary {0: 2, 1: 2, 2: 51, 3: 289, 4: 2381}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952213322_952213328 29 Left 952213322 3:31251278-31251300 CCTTGACTGAAAGTAAATGTGGT No data
Right 952213328 3:31251330-31251352 GAGGATAAAGAGAAGGAAGAAGG 0: 2
1: 2
2: 51
3: 289
4: 2381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952213328 Original CRISPR GAGGATAAAGAGAAGGAAGA AGG Intergenic
Too many off-targets to display for this crispr