ID: 952214934

View in Genome Browser
Species Human (GRCh38)
Location 3:31268882-31268904
Sequence GAGATTAAACATCAAGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952214931_952214934 10 Left 952214931 3:31268849-31268871 CCAGGTTTTCTAACTTCCAATTC No data
Right 952214934 3:31268882-31268904 GAGATTAAACATCAAGAGAAAGG No data
952214930_952214934 11 Left 952214930 3:31268848-31268870 CCCAGGTTTTCTAACTTCCAATT No data
Right 952214934 3:31268882-31268904 GAGATTAAACATCAAGAGAAAGG No data
952214932_952214934 -6 Left 952214932 3:31268865-31268887 CCAATTCAATGATCCAAGAGATT No data
Right 952214934 3:31268882-31268904 GAGATTAAACATCAAGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952214934 Original CRISPR GAGATTAAACATCAAGAGAA AGG Intergenic
No off target data available for this crispr