ID: 952217786

View in Genome Browser
Species Human (GRCh38)
Location 3:31295027-31295049
Sequence GAGGCTATGTCTGTGTGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952217786_952217789 -10 Left 952217786 3:31295027-31295049 CCCCTTCACACAGACATAGCCTC No data
Right 952217789 3:31295040-31295062 ACATAGCCTCAGCATGCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952217786 Original CRISPR GAGGCTATGTCTGTGTGAAG GGG (reversed) Intergenic
No off target data available for this crispr