ID: 952233269

View in Genome Browser
Species Human (GRCh38)
Location 3:31453782-31453804
Sequence ACATATGTGGAGCCAATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 150}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952233269_952233275 13 Left 952233269 3:31453782-31453804 CCATCCATTGGCTCCACATATGT 0: 1
1: 0
2: 1
3: 11
4: 150
Right 952233275 3:31453818-31453840 GAGGAGAGTGCTGCTCCAGGAGG 0: 1
1: 1
2: 3
3: 26
4: 279
952233269_952233272 -9 Left 952233269 3:31453782-31453804 CCATCCATTGGCTCCACATATGT 0: 1
1: 0
2: 1
3: 11
4: 150
Right 952233272 3:31453796-31453818 CACATATGTCTCATCTCAGAAGG 0: 1
1: 1
2: 2
3: 16
4: 160
952233269_952233273 -6 Left 952233269 3:31453782-31453804 CCATCCATTGGCTCCACATATGT 0: 1
1: 0
2: 1
3: 11
4: 150
Right 952233273 3:31453799-31453821 ATATGTCTCATCTCAGAAGGAGG 0: 1
1: 1
2: 1
3: 9
4: 148
952233269_952233274 10 Left 952233269 3:31453782-31453804 CCATCCATTGGCTCCACATATGT 0: 1
1: 0
2: 1
3: 11
4: 150
Right 952233274 3:31453815-31453837 AAGGAGGAGAGTGCTGCTCCAGG 0: 1
1: 1
2: 1
3: 31
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952233269 Original CRISPR ACATATGTGGAGCCAATGGA TGG (reversed) Intergenic
902039744 1:13484039-13484061 AGAGATGGGGAGCCACTGGAGGG - Intronic
902771742 1:18649153-18649175 ACATGAGTGAGGCCAATGGAGGG + Intronic
904908653 1:33917297-33917319 GCACATGAGGAGCCAATAGAAGG - Intronic
905196958 1:36287194-36287216 CCATATGTGGAGCCAGTGGATGG - Exonic
905771065 1:40638334-40638356 ACATGTATGAAGCCAGTGGAGGG - Intronic
908999066 1:70196721-70196743 AGTTATGTGGAGCCAATAGCAGG + Intronic
909217759 1:72912784-72912806 ACATCTGTTGAGGGAATGGATGG - Intergenic
914426473 1:147582059-147582081 ACATATGTGTAGAGAAAGGATGG - Intronic
916436649 1:164784013-164784035 AAAAATGTGGAGCCATTGGTCGG - Intronic
916940676 1:169673974-169673996 ACATATGTACATACAATGGACGG - Intronic
921637320 1:217511953-217511975 ACCTATGTAGAGCCAATGTGGGG - Intronic
921976991 1:221213730-221213752 AAATATGTGGTGGCAATGTAGGG - Intergenic
922873702 1:228923467-228923489 ACATATGTGAAGTAAATGGATGG + Intergenic
924561335 1:245158048-245158070 ACATTTGTGGAGGGAATGTAGGG + Intronic
1063771810 10:9212278-9212300 CGGTATGTGGAGTCAATGGATGG - Intergenic
1064380377 10:14836996-14837018 ATATATGTTGAGTGAATGGATGG - Intronic
1065662862 10:28024001-28024023 ACATGAGTGGAGCCAATTTATGG - Intergenic
1065858269 10:29848440-29848462 ACATATGAGGAGCCCTTCGATGG - Intergenic
1067543882 10:47177986-47178008 AAATATGTGGAGGCCAAGGATGG - Intergenic
1067768931 10:49109767-49109789 ACTAATGTGTAGCCAAAGGAGGG + Intronic
1068884092 10:62080578-62080600 CCAAATATGGAGCCAATAGAAGG - Intronic
1069290788 10:66777259-66777281 ACATATGTGGTGCCAATTTTTGG - Intronic
1070982589 10:80661425-80661447 ACACAAGAGGAGCCAAGGGAAGG + Intergenic
1071109668 10:82141046-82141068 ACATATGGGGAACCAGTTGAAGG + Intronic
1076325534 10:129617909-129617931 ACATGGGAGGAGCCAAAGGATGG + Intronic
1078458895 11:11498071-11498093 TCATATGTGAAACCAATTGAGGG + Intronic
1080193976 11:29585978-29586000 ACACACATGGAGGCAATGGAAGG + Intergenic
1080637609 11:34137690-34137712 AAATATCTGGAGCCAATGAAAGG + Intronic
1080678523 11:34450754-34450776 ACATAGCTGGAGCCAAGAGAAGG - Intronic
1081587787 11:44399026-44399048 TCATATGTGAAGCCACTGAATGG + Intergenic
1082861661 11:57862853-57862875 TCAGATGTGGAGACACTGGATGG + Intergenic
1084633769 11:70375911-70375933 TCTAATGTGGAGTCAATGGATGG - Intronic
1085807619 11:79650770-79650792 AGGTATGTGGAGTCAGTGGATGG - Intergenic
1085960984 11:81461664-81461686 ACACATGTGGAGGGAAGGGAAGG - Intergenic
1092825056 12:12391029-12391051 ACAGAGTTGGAACCAATGGATGG - Intronic
1097991615 12:65840981-65841003 CCAGATGTGGAGCCATAGGAAGG - Intronic
1100354430 12:93816031-93816053 ACATATGTGGCTCCAATTGGTGG - Intronic
1100933932 12:99641528-99641550 ACATCTGTGAAACAAATGGATGG + Intronic
1101612593 12:106304595-106304617 ACATATGTGTAGTAAAGGGAAGG - Intronic
1102500844 12:113351278-113351300 AGATATGGGGAGCCATGGGAGGG + Intronic
1104198624 12:126566263-126566285 ACATATGGGGCGCCTTTGGAGGG - Intergenic
1105818249 13:24056641-24056663 ATATATGTTGAGTGAATGGAAGG + Intronic
1109179199 13:59192798-59192820 TCATCTGTGGAGACAATGGGAGG + Intergenic
1112753411 13:102604865-102604887 ACAGAAGTAGAGCCAAAGGATGG + Exonic
1113822007 13:113221380-113221402 ACATGTGCCGACCCAATGGAAGG - Intronic
1114525910 14:23366609-23366631 ACAGATGTGGGGCTAATGAAAGG - Intergenic
1117495589 14:56299453-56299475 AAAGATGTGGAGCCCATGGAGGG - Exonic
1119847022 14:77838300-77838322 ACATATGTGAAGCTAATTTAAGG + Intronic
1125299412 15:38238564-38238586 ACATATGTAAAGCGCATGGAAGG + Intergenic
1129658267 15:77539122-77539144 ACATTTGGGGAGCCTTTGGAAGG + Intergenic
1130861376 15:87893841-87893863 ATATTTCTGGAACCAATGGAGGG + Intronic
1133619419 16:7512375-7512397 ACATCTCTGGAGCCATTTGAAGG + Intronic
1135804687 16:25532094-25532116 ACAACTGTGGACCCAATGCAGGG + Intergenic
1137274893 16:46926927-46926949 ACATGTCTGGAGCCATTTGATGG - Exonic
1141578809 16:84983226-84983248 ATATAGGTGGGGCAAATGGAAGG + Intronic
1144119526 17:12137185-12137207 ACATATGTTGAACAAATGAATGG + Intronic
1144441254 17:15284464-15284486 ATATATATGGAGCCCATCGAAGG + Intergenic
1148652718 17:49261120-49261142 TGATTTGTGGAGCCAATGGGTGG - Intergenic
1150351928 17:64452061-64452083 ACATAGCTGGGACCAATGGATGG - Intronic
1157548877 18:48566807-48566829 ACATGAGTGGGGCCATTGGAAGG + Intronic
1159429613 18:68334774-68334796 ACATACGTAGAGCCATTGTAGGG + Intergenic
1160548909 18:79680549-79680571 ACAAAGGTGGAGCTAAAGGAAGG - Intronic
929349202 2:40928062-40928084 ACATATATGGAAACACTGGAGGG - Intergenic
933176608 2:79180753-79180775 ACAGATGTGGAACCCATGAATGG - Intergenic
934507754 2:94907620-94907642 ACATATGTGGACACAAAGAAGGG + Intergenic
935102104 2:100006786-100006808 GCGTATGTGAGGCCAATGGACGG - Exonic
935432171 2:102988027-102988049 ACATATGTGCAGACAATGGTAGG + Intergenic
935623524 2:105149303-105149325 ACAAATGTTGAGTGAATGGATGG + Intergenic
938337186 2:130510551-130510573 GCATAAGTGGAGCATATGGATGG - Intergenic
938352651 2:130610180-130610202 GCATAAGTGGAGCATATGGATGG + Intergenic
939426652 2:142047140-142047162 ACAGTTGTGGAGACAATGCAGGG + Intronic
940651712 2:156447281-156447303 ACAGTTGTGGAGGGAATGGAAGG - Intronic
940839047 2:158558434-158558456 ATATCTGTGAAGCCAAAGGAAGG + Intronic
943590043 2:189785489-189785511 CCATATGTGTACCAAATGGAAGG - Intronic
943804464 2:192105723-192105745 ACATATATGCAGAAAATGGAAGG + Intronic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1170794364 20:19533515-19533537 ACCTATGTGGAGCCAGGTGAAGG + Intronic
1171887812 20:30672454-30672476 AAATATGTGGAGAAAATAGAAGG - Intergenic
1172996191 20:39072145-39072167 ACAGAGTTGGAGCCTATGGAGGG - Intergenic
1175733861 20:61372056-61372078 ACAAATGTGGAGCAAAAGTATGG - Intronic
1182862070 22:33568821-33568843 ACATATCTGGAACAGATGGATGG + Intronic
952105270 3:30062792-30062814 ACATTTATTGAGTCAATGGAGGG - Intergenic
952233269 3:31453782-31453804 ACATATGTGGAGCCAATGGATGG - Intergenic
955525383 3:59814608-59814630 ACCTATGTGGGGACAAGGGATGG - Intronic
956100280 3:65760989-65761011 ACATATGTAGCGCCCATAGACGG + Intronic
960440323 3:117678878-117678900 GCAGTTGTGGGGCCAATGGAGGG + Intergenic
960680809 3:120245582-120245604 ACATATGAGAGGCCAATGAATGG - Intronic
961036839 3:123648400-123648422 ACTTCTGTGGATCAAATGGAAGG + Intronic
962858614 3:139374560-139374582 ACATGTGTGCAGACACTGGAAGG - Exonic
962871372 3:139496073-139496095 ACATATAGAGAGCCAATAGAAGG - Intergenic
963090119 3:141476231-141476253 ACATCTGTCCAGCCAATGGCTGG - Intergenic
967374279 3:188783175-188783197 AGAGCTGTGGAGTCAATGGAGGG - Intronic
967704972 3:192639601-192639623 ACAGATGTGGAACTCATGGAGGG - Intronic
969137701 4:5043949-5043971 ACCTATGTGGAGGCAATGGCTGG - Intergenic
970974799 4:22031476-22031498 CCATATGTGCAGCCAAGAGAAGG + Intergenic
971733084 4:30410793-30410815 ACGTTTGTAGAGCAAATGGATGG + Intergenic
973670924 4:53217328-53217350 ACATATGTGCACCCAATACACGG - Intronic
975844071 4:78506741-78506763 ACATTGGTGCAGCCCATGGAGGG - Intronic
975976007 4:80097537-80097559 AGATATGTGGAACCAGTGGAGGG + Intronic
977130475 4:93229481-93229503 ACAGATGTGGGGCCAAAGAAAGG + Intronic
979541152 4:121884366-121884388 ATATAAGTAGAGGCAATGGACGG + Intronic
981047787 4:140281451-140281473 CCATATGTGGAGCCTTGGGATGG - Intronic
982936662 4:161486386-161486408 ACAGATGTTGAGACAAAGGAGGG + Intronic
984070116 4:175100618-175100640 ACCATGGTGGAGCCAATGGATGG + Intergenic
984757174 4:183335907-183335929 ACACATGGGGAGCCAAAGGTGGG - Intergenic
987017020 5:13830943-13830965 ACATATGTTGAGGAAAAGGAGGG + Intronic
987127338 5:14826803-14826825 ACATATGGAGAGCAAATCGATGG - Intronic
988293462 5:29322189-29322211 AAATATGTGTACCTAATGGAAGG - Intergenic
990203656 5:53406023-53406045 ATAGATGTGGAGCCTTTGGAGGG + Intergenic
996366607 5:122708047-122708069 ACAGATGTGGAGCCTTTGTATGG + Intergenic
999527333 5:152421910-152421932 ATATATCTGGAGCCAATTGTAGG + Intronic
999601172 5:153266855-153266877 ACATATGTGGGGCAACAGGAAGG - Intergenic
1000345163 5:160308099-160308121 ACATCTGTGGACCCCTTGGAGGG + Intronic
1002616039 5:180456870-180456892 ACATATGGGGAGGGAAGGGAAGG + Intergenic
1003272787 6:4621983-4622005 ACATATGTACATTCAATGGAAGG + Intergenic
1007905248 6:45453352-45453374 ACCTATGTGGGGACAGTGGAGGG + Intronic
1008268345 6:49460070-49460092 ACATATGTGCAGCCAACTGTAGG - Intronic
1009192438 6:60645637-60645659 ACATATATTCAGCCAATGGAAGG - Intergenic
1010256349 6:73762388-73762410 ACATATGGGAAGCCAGTGAAAGG + Exonic
1011218222 6:85028400-85028422 AGATATGTGGATCTGATGGAGGG - Intergenic
1011511405 6:88105061-88105083 ACATGGGAGGAGCCATTGGAAGG + Intergenic
1013309087 6:108876846-108876868 ATTTATGAGGGGCCAATGGAGGG - Intronic
1013435675 6:110103528-110103550 ACATACGTGGATCATATGGATGG - Exonic
1016250350 6:142033890-142033912 ATATTTGTGGAGTGAATGGATGG - Intergenic
1016441969 6:144094038-144094060 ACCTCTGAGGAGCCATTGGAAGG - Intergenic
1017307615 6:152937499-152937521 ACATACATGGAGTCAAGGGAGGG - Intergenic
1017349658 6:153425551-153425573 GCATATTTGGAGCCAAGGGGAGG + Intergenic
1017582726 6:155884109-155884131 GCTTATGTGGAACTAATGGATGG + Intergenic
1017590384 6:155973026-155973048 ACAGATGAGGAGCACATGGAAGG + Intergenic
1017647630 6:156553643-156553665 ACACATGTGGTGCCTGTGGAGGG - Intergenic
1019530900 7:1502900-1502922 CCATCTGTGGTGCCAATTGAAGG - Exonic
1021314862 7:19135989-19136011 ACATATGTGGGGCCAATGTTTGG + Intergenic
1023608979 7:41955521-41955543 ACAGATGTGGATCAAATGGAAGG + Intergenic
1023962516 7:44938912-44938934 ATATCTGTAGACCCAATGGATGG + Intergenic
1024003872 7:45211243-45211265 ACATCTCAGGAGACAATGGAGGG - Intergenic
1024514050 7:50228852-50228874 CCATGTCTGGAGCCAATGGGAGG - Intergenic
1027416989 7:77984056-77984078 ACACATGTGGAGATAACGGAAGG + Intergenic
1029223429 7:99008209-99008231 CCATCTGTTGAGCAAATGGATGG + Intronic
1032128935 7:129213416-129213438 ACATGTTTGGAGGCTATGGAAGG - Exonic
1033889813 7:145997742-145997764 ACATATGAGAAGCCACTTGAGGG + Intergenic
1037376883 8:18240117-18240139 ACATATTTGGAGCCCTTAGATGG - Intergenic
1037509084 8:19563529-19563551 ACAGATGTGGAGGCAATGGGTGG - Intronic
1042656875 8:71108846-71108868 ACACATATGGTGCCAATGGCAGG - Intergenic
1043499155 8:80836117-80836139 ATAAATGGGGAGCCATTGGAGGG - Intronic
1046357061 8:113101136-113101158 ACCTCTGTGGAGCCCATGAAAGG - Intronic
1046898407 8:119497939-119497961 ACATATGTGGAACATATGTATGG + Intergenic
1047927782 8:129698009-129698031 ACATATGTGGGGTCACAGGAGGG - Intergenic
1048294117 8:133201882-133201904 ACATGTGTGGGGAAAATGGAAGG + Intronic
1051444149 9:17122369-17122391 TGATATGTGGAGTGAATGGAGGG + Intergenic
1052894930 9:33738005-33738027 ACAGAGGTGGAACCAATTGAAGG - Intergenic
1055642876 9:78334463-78334485 ACATGGGTGCAGCCCATGGAGGG + Intergenic
1056479559 9:86987461-86987483 ACATATGTGGAACCCATGAATGG + Intergenic
1060220234 9:121760640-121760662 GCCTGTGTGGAGCCAGTGGATGG + Intronic
1185760482 X:2686875-2686897 TCATATTTGGAGCCAAAGAATGG + Intergenic
1188809801 X:34639463-34639485 ACATCTGTTGAGCCACTGCAAGG - Intronic
1188822363 X:34790803-34790825 AGAAATGTGAAGCCAATTGAAGG + Intergenic
1192198753 X:69050148-69050170 AGAGATGAGGAGCCATTGGAGGG + Intergenic
1193009099 X:76656005-76656027 ACATTTTTGCAGTCAATGGAAGG - Intergenic
1194277402 X:91902264-91902286 ACATATGAGTAGTGAATGGAGGG - Intronic
1197284485 X:124580289-124580311 ACACATGTGTAGCAAATGGCAGG - Intronic
1199636361 X:149816407-149816429 GCATATGTGGACACAAAGGAGGG + Intergenic
1200282640 X:154790933-154790955 ACACTTATGGAGACAATGGAAGG + Intronic
1200594744 Y:5124361-5124383 ACATATGAGTAGTGAATGGAGGG - Intronic