ID: 952233810

View in Genome Browser
Species Human (GRCh38)
Location 3:31458456-31458478
Sequence CTGTAATCCCAGATACTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952233807_952233810 -3 Left 952233807 3:31458436-31458458 CCAGACATGGTGGTGTGCACCTG 0: 82
1: 1770
2: 8234
3: 27430
4: 60154
Right 952233810 3:31458456-31458478 CTGTAATCCCAGATACTGGCTGG No data
952233803_952233810 17 Left 952233803 3:31458416-31458438 CCCTGTCTCTACAGGGTTAGCCA No data
Right 952233810 3:31458456-31458478 CTGTAATCCCAGATACTGGCTGG No data
952233804_952233810 16 Left 952233804 3:31458417-31458439 CCTGTCTCTACAGGGTTAGCCAG No data
Right 952233810 3:31458456-31458478 CTGTAATCCCAGATACTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952233810 Original CRISPR CTGTAATCCCAGATACTGGC TGG Intergenic
No off target data available for this crispr