ID: 952238956

View in Genome Browser
Species Human (GRCh38)
Location 3:31510027-31510049
Sequence GTTTCATTTGAACAGCTCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952238953_952238956 -9 Left 952238953 3:31510013-31510035 CCAGTGGCCCTAGAGTTTCATTT No data
Right 952238956 3:31510027-31510049 GTTTCATTTGAACAGCTCAATGG No data
952238951_952238956 -1 Left 952238951 3:31510005-31510027 CCTCATTCCCAGTGGCCCTAGAG No data
Right 952238956 3:31510027-31510049 GTTTCATTTGAACAGCTCAATGG No data
952238950_952238956 3 Left 952238950 3:31510001-31510023 CCTGCCTCATTCCCAGTGGCCCT No data
Right 952238956 3:31510027-31510049 GTTTCATTTGAACAGCTCAATGG No data
952238948_952238956 14 Left 952238948 3:31509990-31510012 CCTGAACTATGCCTGCCTCATTC No data
Right 952238956 3:31510027-31510049 GTTTCATTTGAACAGCTCAATGG No data
952238952_952238956 -8 Left 952238952 3:31510012-31510034 CCCAGTGGCCCTAGAGTTTCATT No data
Right 952238956 3:31510027-31510049 GTTTCATTTGAACAGCTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952238956 Original CRISPR GTTTCATTTGAACAGCTCAA TGG Intergenic
No off target data available for this crispr