ID: 952241193

View in Genome Browser
Species Human (GRCh38)
Location 3:31532837-31532859
Sequence GCGCCGCGAGGCCGGCGGAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952241193 Original CRISPR GCGCCGCGAGGCCGGCGGAC TGG (reversed) Exonic
900349545 1:2228154-2228176 GGGCCGCGGAGCCGGCGGGCGGG + Intergenic
903597097 1:24503069-24503091 GAGCCGGGAGGGCAGCGGACGGG - Exonic
910676614 1:89821790-89821812 GCGCTGGGAGCCCGGCGGGCGGG + Intronic
913300671 1:117366738-117366760 GCGGCGCGAGGCCGGAGCCCGGG + Intergenic
916414037 1:164576389-164576411 GCGGCGCCGCGCCGGCGGACCGG - Intronic
923372654 1:233328331-233328353 GCGGCGCGGGGCTGGCGGCCGGG - Exonic
923372661 1:233328345-233328367 GGGCCGCGAGGGCGGCGGCGCGG - Exonic
1065186530 10:23174613-23174635 GCTCCGCGAGGCCGGCGGGGCGG - Intergenic
1068970157 10:62950038-62950060 GCGCAGCGAGGCTGGGGGAGGGG + Intergenic
1070609988 10:77926563-77926585 GCCCCCCGAGGCCGGCGGGCGGG + Intergenic
1071857981 10:89645087-89645109 GCGCCGTGGGGCCGGCGCGCGGG - Exonic
1072700925 10:97640879-97640901 GCCCGGCGAGCCCGGCGGAGAGG - Exonic
1073063968 10:100747837-100747859 GGGCCGCGAGGCAGGCTGGCTGG - Intronic
1073109118 10:101050380-101050402 GCGGCGCGGGGCAGGCGGGCGGG - Intergenic
1074586005 10:114768224-114768246 GCGCAGCAAGGCCGACGGGCGGG + Intergenic
1077043501 11:534774-534796 GCGCCGCGGGGCCTGCAGGCTGG - Intronic
1077299104 11:1839049-1839071 GCCCGCCGAGGCCGGGGGACAGG + Intronic
1083246050 11:61429423-61429445 GCGGCGCGAGGCCGGGGGCGGGG - Intronic
1083628532 11:64084324-64084346 GCTCCTCGAGGCTGGGGGACAGG - Intronic
1083747692 11:64744800-64744822 CCGCAGCGAGGCCGGCGGGCGGG - Intronic
1083965795 11:66042956-66042978 GCGCCGCGGGGATGGCGGCCAGG + Exonic
1086666569 11:89491243-89491265 GCGCGGCGGGGCCGGCGGCATGG - Exonic
1088481059 11:110296676-110296698 GCGGCGCGAGGACGGCCGGCCGG - Exonic
1094199322 12:27780456-27780478 GAGCCAGGAGGCCGGCGGCCCGG + Exonic
1099956187 12:89353970-89353992 GCGCCGCGGGGCGGACGGATTGG + Intergenic
1104891711 12:132143471-132143493 GCGCGGCGCGGCGGGAGGACAGG + Intronic
1105492638 13:20903051-20903073 GCACCGCGAGGCCGGGGCGCCGG - Intergenic
1114554157 14:23551857-23551879 GTCCCGCGAGGCAGGCGGGCGGG - Intronic
1115754208 14:36517376-36517398 GCGCCGCGGGGCTGGCGGCGTGG + Exonic
1119219462 14:72894172-72894194 GCGCCGATTGGCCGGCGGGCCGG - Intergenic
1119438141 14:74611451-74611473 CCGCCGCGAGGGCGGCTCACGGG - Exonic
1124427047 15:29570949-29570971 GCGCGGCGCGGCCGGCGGGCGGG - Intergenic
1124966730 15:34437440-34437462 GCGCGGCGAGGACGGCGGCGCGG - Intronic
1124966734 15:34437457-34437479 GCGCGGCGAGGACGGCGGCGCGG - Intronic
1124966738 15:34437474-34437496 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1124966742 15:34437491-34437513 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1124966746 15:34437508-34437530 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1124966750 15:34437525-34437547 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1124966754 15:34437542-34437564 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1124966758 15:34437559-34437581 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1124966762 15:34437576-34437598 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1124966766 15:34437593-34437615 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1124966770 15:34437610-34437632 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1124966774 15:34437627-34437649 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1124966778 15:34437644-34437666 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1124966782 15:34437661-34437683 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1124966786 15:34437678-34437700 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1124966790 15:34437695-34437717 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1125626837 15:41115992-41116014 CCGCCGCGACGGCGGCGGAGGGG + Exonic
1126736682 15:51737730-51737752 GTTCCGCGGGGGCGGCGGACGGG + Exonic
1127415006 15:58749431-58749453 GCGCCGCGACCACGGCGGAGCGG - Intronic
1132580818 16:683939-683961 GGGCGGCGAGGCTGGCGGTCCGG - Intronic
1132646782 16:1002922-1002944 GCGACGCGATGCCGGTGGCCTGG - Intergenic
1132885130 16:2179135-2179157 GCCCAGCGAGGGCGGCGTACCGG + Exonic
1133784339 16:8963325-8963347 GGGCTGCGAGCCCGGCGGGCGGG + Exonic
1136413894 16:30092033-30092055 GGGCTGCGAGGCCGGCGGCGCGG + Intergenic
1138016617 16:53434458-53434480 GCGCGGTGCGGGCGGCGGACGGG + Exonic
1143223677 17:5282462-5282484 GCTCCCCGAGGCCGGCCGCCTGG + Exonic
1148207048 17:45785350-45785372 GGGCCGGGAGGCCGGCAGTCCGG + Intronic
1148549703 17:48543283-48543305 GCTGCGCGGGGCCGGCGGGCTGG - Exonic
1148556455 17:48581638-48581660 GGGCCGCTGGGCCGGCGGCCGGG + Intronic
1151155008 17:72118032-72118054 GCGCCGCGAGGTCTGCCGCCGGG - Intergenic
1152245541 17:79183037-79183059 GCGGCGCGAGGCGGGGGGGCCGG - Intronic
1152463864 17:80455049-80455071 GCTCCGGGAGGGCGGCGGGCCGG - Intergenic
1152938287 17:83153010-83153032 GGGCCGTGAAGCCGCCGGACTGG - Intergenic
1156099633 18:33578375-33578397 GCGGCGCGCGGCGGGCGGGCCGG - Intergenic
1157545163 18:48541231-48541253 GCGCCGGGCGGGCGGCGGCCTGG - Intronic
1160297571 18:77651667-77651689 ACGCCGGGAGGCCGACGGACAGG + Intergenic
1160688197 19:447186-447208 GCACCGTGAGGACGCCGGACAGG + Intronic
1160861232 19:1237969-1237991 GCGCAGCGGGGGCGGCGGGCCGG - Exonic
1160991894 19:1863511-1863533 GCGCGGCGCGGCGGGCGGAGCGG + Exonic
1161087022 19:2340042-2340064 GGGCCGTGAGGCCGGGGGCCAGG - Intronic
1161290576 19:3491629-3491651 GCGCGGCCAGGCAGGCGGGCCGG + Exonic
1161495003 19:4581694-4581716 GCGCTGCGCGGCGGCCGGACCGG + Intergenic
1162461635 19:10817250-10817272 GAGCCCCGAGGCCGGCCGAGGGG - Intronic
1163026921 19:14517998-14518020 GGCCCGCGAGGCCGGAGGGCGGG + Intronic
1163138644 19:15331955-15331977 CCGCGGCGGGGCCGGCGGTCGGG - Intronic
1163427140 19:17245888-17245910 GCAGCGCGAGGCCGGCGCGCGGG - Exonic
1163529765 19:17842492-17842514 GCGCCGCGTGGCCGCCTGCCAGG - Exonic
1165157269 19:33796251-33796273 GCGCCGCGTGGCCGGCCGGCGGG + Intronic
1167497891 19:49830129-49830151 GCGGCGGGAGGCAGGGGGACTGG - Exonic
924962367 2:46284-46306 ACGCCGCGCGGCCGGCGCGCAGG - Exonic
925766162 2:7237633-7237655 CCGCCGCAGGGCCTGCGGACTGG - Intergenic
927964884 2:27262528-27262550 GCGCCGCGGGGGTGGCGGAGGGG + Intronic
928463357 2:31496722-31496744 GCGCAGCGAGGCTGGGGGAGGGG + Intergenic
928928048 2:36598128-36598150 GGGCGGCGATGGCGGCGGACGGG - Exonic
932231376 2:70086978-70087000 GCGAGGCGAGGCCTGCGGAGCGG - Intergenic
936122849 2:109760973-109760995 CCGCCGCGAGGGAGGCGAACAGG - Intergenic
936221839 2:110610491-110610513 CCGCCGCGAGGGAGGCGAACAGG + Intergenic
937408001 2:121648890-121648912 GTGCCGGGAGGCGGGCGGCCCGG - Intronic
938451443 2:131425012-131425034 CCGCCGCGGGGGCGGCGGCCAGG + Intergenic
942947034 2:181683191-181683213 GCGTCGCGATGCCGGCGCCCCGG - Intergenic
947800720 2:232927583-232927605 GCGCCGTGTGGCCTGGGGACGGG - Intronic
1169164153 20:3407807-3407829 AAGCTGCGAGGCCGCCGGACCGG + Intergenic
1173672918 20:44810426-44810448 GCGCGGCGGGGCCGGCGGGCGGG + Intergenic
1173826611 20:46051767-46051789 GCCCCCCGAGGCCCCCGGACTGG - Exonic
1175429479 20:58891548-58891570 GGGCCGCGGGGCGCGCGGACGGG - Intronic
1176173451 20:63706951-63706973 GCGCCGCCAGGCCGTGGGAAAGG + Intronic
1176548461 21:8211876-8211898 GCGCGGCGGGGCCGGACGACGGG - Intergenic
1176556355 21:8256084-8256106 GCGCGGCGGGGCCGGACGACGGG - Intergenic
1176567392 21:8394911-8394933 GCGCGGCGGGGCCGGACGACGGG - Intergenic
1176575294 21:8439126-8439148 GCGCGGCGGGGCCGGACGACGGG - Intergenic
1178104046 21:29299020-29299042 GTGAGGGGAGGCCGGCGGACAGG + Intronic
1181695985 22:24593011-24593033 GCGCGGCTGGGCCGGCGGGCCGG - Exonic
1182435476 22:30326969-30326991 CCGCCGCAAGGCCGGGGGGCGGG + Intronic
1184834046 22:47010300-47010322 GCGCAGCCAGGCCGGGGAACAGG + Intronic
1185388374 22:50546843-50546865 GCCCCGCGGGGCCTGCGGCCTGG - Intergenic
1203253345 22_KI270733v1_random:128181-128203 GCGCGGCGGGGCCGGACGACGGG - Intergenic
1203261399 22_KI270733v1_random:173259-173281 GCGCGGCGGGGCCGGACGACGGG - Intergenic
950316240 3:12004349-12004371 GCGGCGCGAGGCTCGCGGAGAGG - Intergenic
950404562 3:12796689-12796711 GCGCCGCGGAGCCGGCCGGCGGG - Exonic
952241193 3:31532837-31532859 GCGCCGCGAGGCCGGCGGACTGG - Exonic
954076906 3:48188179-48188201 ACACCGCGAGGCCAGCGGGCGGG + Exonic
954367539 3:50154618-50154640 GCGCCGCGGGGCCCACGCACGGG + Intergenic
956681416 3:71785120-71785142 GCGCGGAGCGGCGGGCGGACGGG + Intronic
956761303 3:72447211-72447233 GCGCCGCGAGGGCGGAGGCGGGG + Intergenic
958949400 3:100400736-100400758 GCGCCGGGAGGCCAGAGGCCGGG - Exonic
964743279 3:159988921-159988943 GCGCCGCAAGCCCCGCGGGCCGG + Exonic
968213435 3:196868168-196868190 GCGGCTCGAGGCCTCCGGACCGG - Intronic
968697998 4:2042137-2042159 GGGCCCGGAGACCGGCGGACTGG + Intronic
968756424 4:2418467-2418489 GCGCCGAGCGGGCGGCGGGCAGG + Exonic
968775459 4:2537047-2537069 GGGCCGCCAGGCCCGCGGCCTGG - Intronic
968936672 4:3614622-3614644 GCGCCGGGAGGCTGGCTGGCTGG - Intergenic
976874470 4:89836922-89836944 GCGACGCGAGGCTGGGGGAGTGG + Intronic
983656480 4:170089985-170090007 GCGCGGCGAGGCCCGCGGCGGGG - Intronic
993900385 5:93580531-93580553 GGGCGGCTGGGCCGGCGGACTGG + Intergenic
997304074 5:132825724-132825746 GGCCCTCGAGGCCGGCGGGCTGG + Exonic
998797465 5:145835258-145835280 GCGCCGCGGGCCCCGCGCACCGG + Exonic
1003097984 6:3157276-3157298 CCGCGGCGAGGCCGCCGGGCGGG - Intronic
1006318343 6:33304325-33304347 GCGCCCCGAGGCAGGCAGGCTGG + Exonic
1011517250 6:88166987-88167009 GCGCCCCGAGGGCGGAGGACAGG - Intergenic
1016328228 6:142927014-142927036 GCGGCGCGGGGCGGGCGGCCAGG + Intronic
1017253036 6:152302227-152302249 GCGCCGCGCAGCCTGCGGTCTGG - Intronic
1018774008 6:166998173-166998195 GACCCGCGTGGCCGGCGGAAAGG - Intergenic
1020383111 7:7567203-7567225 GCGCCGGGCGGCCGGCCGCCTGG + Intronic
1025691844 7:63756866-63756888 GCCCGGAGAGGCCGCCGGACGGG - Intergenic
1025693155 7:63762191-63762213 GCCCGGAGAGGCCGCCGGACGGG - Intergenic
1026360554 7:69598439-69598461 GCTGCGCGAGGCAGGCGGGCGGG + Intergenic
1026923840 7:74174891-74174913 TCGCCACGAGGCCGGCCGACTGG + Intronic
1035401590 7:158569682-158569704 GGGGCGCGAGGCCGCCTGACAGG + Intronic
1035401632 7:158569870-158569892 GGGGCGCGAGGCCGCCTGACAGG + Intronic
1035401639 7:158569898-158569920 GGGGCGCGAGGCCGCCTGACAGG + Intronic
1036454179 8:8893361-8893383 GCGCCGCGCGGCGGGCGGAGAGG - Exonic
1044692774 8:94895869-94895891 GCCGCGCAAGGCCGGCGGAGCGG - Intronic
1048985168 8:139731192-139731214 GGGCCCCGAGGCAGGCCGACTGG + Exonic
1049635175 8:143684367-143684389 GCGGGGCGAGGCGGGCGGCCTGG + Intergenic
1049819093 8:144623550-144623572 GTGCCGCGAGGCCGCCTGTCAGG - Intergenic
1050091311 9:2017729-2017751 TGGCGGCGCGGCCGGCGGACGGG - Intronic
1051170317 9:14314328-14314350 GCGGGGCGAGGCGGGCGGGCGGG - Intronic
1051404940 9:16727113-16727135 GCGCCGGCGGGCCGGCGGGCGGG + Intronic
1055611713 9:78031380-78031402 CCGCCGCGGGGGCGGCGGCCAGG + Exonic
1056643371 9:88388884-88388906 GGGCGGGGAGGCCGGCGGGCAGG + Intronic
1057121004 9:92573805-92573827 CGGCCGCGAGGCTGGGGGACAGG - Intronic
1059208449 9:112487376-112487398 GCGGCCCGGGGCAGGCGGACCGG - Intronic
1061843875 9:133376062-133376084 GCGGAGCGAGGCCGGCCGCCGGG - Exonic
1061991788 9:134163341-134163363 GCGGGGCGAGGCCGGAGGCCGGG - Intergenic
1062230744 9:135480146-135480168 GCTCCCCGAGGCAGGCGGACGGG + Intronic
1062569604 9:137179074-137179096 CCGCCAGGAGGCCGGCGGGCGGG - Intronic
1203469745 Un_GL000220v1:111328-111350 GCGCGGCGGGGCCGGACGACGGG - Intergenic
1203477566 Un_GL000220v1:155300-155322 GCGCGGCGGGGCCGGACGACGGG - Intergenic
1187464409 X:19515024-19515046 GGGCGGCGCGGCCGGCGGCCCGG - Exonic
1189322817 X:40096845-40096867 GCGCCGCGAGTCGGGCGGAGGGG - Intronic
1198534638 X:137574310-137574332 GGGCGGCGAGGCCTGGGGACTGG + Intronic
1198750291 X:139932143-139932165 GAGCAGCGAGGCGGGCGGCCGGG + Intronic
1200126814 X:153819104-153819126 GCGCCGCGACGGCGGCGGGGTGG + Intronic
1200147631 X:153934834-153934856 GCGCCGCGTGGGCGCCGGGCCGG - Intronic
1200216865 X:154371839-154371861 CCGCTGCCGGGCCGGCGGACGGG - Intronic
1201222955 Y:11789465-11789487 GCGGCGCGAGGCCTGCTGGCCGG - Intergenic