ID: 952241276

View in Genome Browser
Species Human (GRCh38)
Location 3:31533113-31533135
Sequence CAGTGCGCGCACAAGGCGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 32}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952241263_952241276 5 Left 952241263 3:31533085-31533107 CCGGCACGGCCACCACGGGCCCG 0: 1
1: 0
2: 3
3: 15
4: 159
Right 952241276 3:31533113-31533135 CAGTGCGCGCACAAGGCGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 32
952241259_952241276 18 Left 952241259 3:31533072-31533094 CCCTGGGAAACAGCCGGCACGGC 0: 1
1: 0
2: 1
3: 10
4: 72
Right 952241276 3:31533113-31533135 CAGTGCGCGCACAAGGCGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 32
952241267_952241276 -4 Left 952241267 3:31533094-31533116 CCACCACGGGCCCGGGGCCCAGT 0: 1
1: 0
2: 2
3: 19
4: 162
Right 952241276 3:31533113-31533135 CAGTGCGCGCACAAGGCGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 32
952241268_952241276 -7 Left 952241268 3:31533097-31533119 CCACGGGCCCGGGGCCCAGTGCG 0: 1
1: 0
2: 1
3: 16
4: 266
Right 952241276 3:31533113-31533135 CAGTGCGCGCACAAGGCGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 32
952241256_952241276 26 Left 952241256 3:31533064-31533086 CCTCATGGCCCTGGGAAACAGCC 0: 1
1: 0
2: 0
3: 22
4: 299
Right 952241276 3:31533113-31533135 CAGTGCGCGCACAAGGCGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 32
952241260_952241276 17 Left 952241260 3:31533073-31533095 CCTGGGAAACAGCCGGCACGGCC 0: 1
1: 0
2: 2
3: 10
4: 102
Right 952241276 3:31533113-31533135 CAGTGCGCGCACAAGGCGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952241276 Original CRISPR CAGTGCGCGCACAAGGCGGC GGG Exonic
912353866 1:109039790-109039812 CATTGCGAGCCCAAGGCGGGTGG + Intronic
913231256 1:116742399-116742421 CAGTCAGTGCTCAAGGCGGCAGG + Intergenic
1066703943 10:38157352-38157374 GAGTGCGGGCACATGGCGCCTGG + Intergenic
1070827655 10:79400647-79400669 CAGTGCGCCCCCTAGGGGGCAGG - Intronic
1094844975 12:34357527-34357549 CAGGGCCAGCCCAAGGCGGCAGG - Intergenic
1094847145 12:34366319-34366341 CAGGGCCAGCCCAAGGCGGCGGG - Intergenic
1097712897 12:62934760-62934782 CGGTGCGAGCAGGAGGCGGCGGG + Exonic
1122987017 14:105217188-105217210 CAGAGCAGGCACAGGGCGGCAGG + Intronic
1129112520 15:73345865-73345887 CAGAGCGGGTGCAAGGCGGCTGG + Intronic
1133032664 16:3018798-3018820 CAGTGCGAGGCCAAGGCGGGCGG - Intronic
1142764740 17:2058773-2058795 CAGGGCGCTCACCTGGCGGCCGG + Exonic
1143452546 17:7044129-7044151 CCCTGCGCGCAGCAGGCGGCAGG - Intergenic
1149600879 17:57892303-57892325 CAGTGCCAGCACCAGGGGGCAGG + Intronic
1160810673 19:1011662-1011684 CACTGCGGGCACAGGGCGGCGGG + Exonic
1163651663 19:18521573-18521595 CAGTTTGCGCACCTGGCGGCGGG - Intronic
930100844 2:47601599-47601621 CAGTGCGCGAAGGAGGGGGCAGG + Intergenic
934754727 2:96816995-96817017 CAGCGCCCGCTCACGGCGGCCGG - Exonic
948237569 2:236402062-236402084 CAGTGCGTGCCCCAGGTGGCTGG + Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1182243669 22:28937391-28937413 CAGTACGTGCACCAGGAGGCAGG - Intronic
952241276 3:31533113-31533135 CAGTGCGCGCACAAGGCGGCGGG + Exonic
953531692 3:43745494-43745516 CAGTGGGCACAGCAGGCGGCAGG + Intergenic
955918442 3:63929819-63929841 CAGGGCGGGCACAAGGCCGATGG + Intronic
962807466 3:138937772-138937794 CTGTGCACGCACAAGACTGCAGG - Intergenic
968705656 4:2076212-2076234 AAGTGCAAGCACAAGGCGGACGG + Intronic
969638775 4:8384585-8384607 CATTGGGTGCACAGGGCGGCTGG - Intronic
1006906312 6:37535965-37535987 CACTGCGAGCACAACCCGGCAGG - Intergenic
1008511935 6:52284347-52284369 CCGGGCGCGCAAAAGGCGACAGG - Intronic
1019620370 7:1988840-1988862 CTGTGCCCGCACCAGGCTGCAGG + Intronic
1030820163 7:114084930-114084952 CGGCGCGCGGAAAAGGCGGCCGG + Intergenic
1039460095 8:37736689-37736711 CAGCGCGCGCACGAAGGGGCGGG - Exonic
1059107616 9:111525174-111525196 GAGTGCGCGCGCAAGCCTGCGGG - Intronic
1062446262 9:136596597-136596619 CAGGGCCCGCACACGGCAGCCGG - Intergenic
1190862636 X:54358651-54358673 CAGTGCGCGCGCGCGGGGGCTGG + Intergenic