ID: 952241284

View in Genome Browser
Species Human (GRCh38)
Location 3:31533147-31533169
Sequence CGCCGAAGCCGGCCCCGGCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 134}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952241269_952241284 20 Left 952241269 3:31533104-31533126 CCCGGGGCCCAGTGCGCGCACAA 0: 1
1: 0
2: 0
3: 7
4: 93
Right 952241284 3:31533147-31533169 CGCCGAAGCCGGCCCCGGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 134
952241267_952241284 30 Left 952241267 3:31533094-31533116 CCACCACGGGCCCGGGGCCCAGT 0: 1
1: 0
2: 2
3: 19
4: 162
Right 952241284 3:31533147-31533169 CGCCGAAGCCGGCCCCGGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 134
952241268_952241284 27 Left 952241268 3:31533097-31533119 CCACGGGCCCGGGGCCCAGTGCG 0: 1
1: 0
2: 1
3: 16
4: 266
Right 952241284 3:31533147-31533169 CGCCGAAGCCGGCCCCGGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 134
952241270_952241284 19 Left 952241270 3:31533105-31533127 CCGGGGCCCAGTGCGCGCACAAG 0: 1
1: 0
2: 0
3: 7
4: 95
Right 952241284 3:31533147-31533169 CGCCGAAGCCGGCCCCGGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 134
952241274_952241284 12 Left 952241274 3:31533112-31533134 CCAGTGCGCGCACAAGGCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 47
Right 952241284 3:31533147-31533169 CGCCGAAGCCGGCCCCGGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 134
952241273_952241284 13 Left 952241273 3:31533111-31533133 CCCAGTGCGCGCACAAGGCGGCG 0: 1
1: 0
2: 0
3: 0
4: 26
Right 952241284 3:31533147-31533169 CGCCGAAGCCGGCCCCGGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952241284 Original CRISPR CGCCGAAGCCGGCCCCGGCG GGG Exonic
901016703 1:6235991-6236013 CGCCGATGCCGGCCCGGGAAGGG + Intergenic
902620682 1:17649019-17649041 CGCCAAAGCCGGCTCCCGCCTGG - Intronic
903324736 1:22563445-22563467 CGCCGCCGCCGCCCCGGGCGGGG - Intergenic
905912255 1:41662710-41662732 CGCCGGAGCCGGGGCGGGCGCGG - Intronic
912354052 1:109041356-109041378 GGCCAAAACCGGCCCCAGCGGGG + Intronic
913109328 1:115642794-115642816 TGGCGAAGGCTGCCCCGGCGCGG - Intronic
917788878 1:178487008-178487030 TGCTGAAGCCGGGCCCTGCGAGG + Intergenic
920184656 1:204152238-204152260 CCGGGAAGCCAGCCCCGGCGGGG - Intergenic
922307447 1:224356833-224356855 CGCCTCAGCCAGCCCCGGCAAGG + Exonic
923171440 1:231421450-231421472 TGCCGAAGCCGAGCCCGGCAAGG - Exonic
923783021 1:237042487-237042509 CTCGGGAGCCGGCCCCGGCGAGG + Exonic
1064553049 10:16521398-16521420 GGCTGCAGCCGGCGCCGGCGCGG + Exonic
1070255954 10:74813465-74813487 CCCCGAAGCCACCCCAGGCGCGG - Intergenic
1072656809 10:97335127-97335149 CGTCGAAGCCGGACCCGCGGCGG - Intergenic
1075430461 10:122375351-122375373 GGCCGAAGCCGGCTCCGCCCTGG + Intronic
1076402091 10:130190971-130190993 CGGCCAAGCCGGCCCAGGCTTGG - Intergenic
1076554364 10:131311981-131312003 CGCCGATGCCGGCCCCCTGGTGG + Intergenic
1077524771 11:3057448-3057470 CCCGGAAGACGGGCCCGGCGTGG - Intronic
1081700148 11:45147366-45147388 CCCCGCAGCAGCCCCCGGCGCGG - Exonic
1083448507 11:62726991-62727013 CGGCGGGGCCGGGCCCGGCGGGG - Exonic
1084304410 11:68272116-68272138 GGCCCGAGCCGGCCCCGGGGAGG - Intergenic
1084336491 11:68460847-68460869 CGCCGGAGCAGGCCGCGGCGCGG + Intronic
1084758329 11:71252595-71252617 CGCGGGAGCTGGCTCCGGCGAGG + Intergenic
1085022493 11:73218271-73218293 CCCCGAAGCCGGGCCAGGCAGGG - Intergenic
1096674895 12:53221125-53221147 CGCTGAAGACGGCCTGGGCGGGG - Intronic
1096693042 12:53332916-53332938 CGCCGACGCCGTCCCCCGCCCGG + Intronic
1102289267 12:111685717-111685739 CGCTGAAGCCGAAGCCGGCGGGG + Exonic
1104950930 12:132439580-132439602 ATCCACAGCCGGCCCCGGCGAGG - Intergenic
1113311919 13:109140598-109140620 CGACGACGGCGGCCCGGGCGCGG + Exonic
1113494055 13:110714015-110714037 GGCCGAAGCAGGAGCCGGCGGGG + Intronic
1113655908 13:112067730-112067752 CGCCGCCGCCCGCCCCGGCGGGG - Exonic
1116945448 14:50831188-50831210 GGGCGACGCCGGCCCCGGCGCGG + Intergenic
1118909406 14:70048896-70048918 CGGCGAAGCAGGCCCAGCCGTGG + Exonic
1124500447 15:30223302-30223324 CCCCGGCCCCGGCCCCGGCGCGG - Intergenic
1124743127 15:32315365-32315387 CCCCGGCCCCGGCCCCGGCGCGG + Intergenic
1125510726 15:40291140-40291162 CGCCGGAGCCGCGCCGGGCGAGG - Exonic
1126767000 15:52019433-52019455 CGCCGCCGCCGGGCCCGCCGCGG - Intronic
1127103304 15:55588443-55588465 CCCCGAAGCCCGTCCCCGCGCGG - Intronic
1129162117 15:73752858-73752880 CGCCGAACCCAGCCCGGCCGGGG - Intergenic
1129322493 15:74782670-74782692 CGCTGATGCCGCCCGCGGCGAGG + Exonic
1129592756 15:76931892-76931914 CGCCGCGGCCGGCGCCGGCAAGG + Exonic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1132055793 15:98649413-98649435 CTCCGAAGGCGGCGCCGCCGGGG - Exonic
1133076336 16:3283656-3283678 CGCCGGAGCCGGCCGCGCCTGGG + Exonic
1133784372 16:8963420-8963442 CGGCGACGGCGGCCCCGGGGCGG + Exonic
1134290881 16:12902199-12902221 CTCCGGAGGCGGCCCCGGAGCGG - Exonic
1140096881 16:71883608-71883630 CGCCGGGGCCGTCCCCGCCGGGG + Intronic
1142764066 17:2056069-2056091 CGCGAAGGCCGGGCCCGGCGCGG - Intronic
1145925655 17:28644952-28644974 CGCCGCCGCCGCCGCCGGCGCGG + Intronic
1146896383 17:36544981-36545003 CGCCCACGCCGGCCCTGACGCGG + Exonic
1148684774 17:49495301-49495323 CGCCGGAGCTGGCCGCGGCTCGG - Exonic
1148786831 17:50149725-50149747 CGCCGCCGCCCGCCCCGTCGGGG - Exonic
1148849330 17:50547253-50547275 CGGCGAGGCCTGCACCGGCGCGG - Exonic
1152638339 17:81439339-81439361 CACCGATGCCGGCCCCTGTGGGG - Intronic
1152870881 17:82752406-82752428 CGCCGAACCCGGGCCGGGGGAGG - Intronic
1160453617 18:78980717-78980739 CGCTGAGGCCGGCGGCGGCGGGG + Intronic
1160690162 19:457981-458003 GGCGGAAGCCGGTCCCGGGGAGG + Intronic
1160719164 19:589998-590020 CGGCGGCGGCGGCCCCGGCGCGG - Exonic
1160719299 19:590346-590368 CGCCGGCCCCGGCCCCGGCGCGG - Exonic
1161175806 19:2841662-2841684 CGCGGGGGGCGGCCCCGGCGAGG + Intronic
1162778707 19:12995794-12995816 CGCGGCGGCCGGCCGCGGCGAGG - Exonic
1163310172 19:16509569-16509591 CCCCGAGGCAGGCCCAGGCGAGG + Exonic
1163607041 19:18281241-18281263 CGCCGACGGCGCCCCCAGCGCGG - Exonic
1164835115 19:31350885-31350907 GCCCGGAGCCGGCCCCGGCGCGG - Intergenic
1165058638 19:33194457-33194479 GGCCCAGGCCGGCCGCGGCGGGG + Intronic
1166389638 19:42401859-42401881 CGCCGGAGCCGGGCCGAGCGGGG - Exonic
1166991910 19:46697702-46697724 CGCCGTACCCGGCCCCGCCCCGG + Intronic
1167258004 19:48442688-48442710 CCCGGGAGCCGGCCGCGGCGCGG - Exonic
1167293219 19:48635692-48635714 CGCCGGAGCCGTCGCCCGCGCGG - Exonic
925984897 2:9207326-9207348 CTCCGAAGCCGGACGCGGCCGGG + Intronic
927498494 2:23565992-23566014 GGCAGAAGCCGGCCCCTGCCTGG - Intronic
928606161 2:32946989-32947011 CGCCGCAGCGGGGCCCGGCGAGG - Exonic
929501164 2:42493069-42493091 CGACGAGGCGCGCCCCGGCGGGG - Exonic
933666946 2:84971515-84971537 CGCCGCGCCCGGCCCGGGCGGGG - Intronic
937182980 2:120012927-120012949 CGGCGAGGCCGGGCCCGGCCGGG - Intergenic
942450919 2:176107631-176107653 CGCCGCCGCCGCCCCCGCCGGGG - Exonic
945225877 2:207530484-207530506 CGCCGCCGCCGGGCCGGGCGCGG + Intronic
946404564 2:219485357-219485379 AGCCGAAGCCGGCTCCGCTGGGG + Exonic
946422022 2:219570665-219570687 CGCCGGGGCCGTCCTCGGCGCGG + Exonic
948386105 2:237582035-237582057 CTCCGCAGCAGGCCCTGGCGGGG + Intronic
948415349 2:237798897-237798919 CGGCGAAGCCGGCGAGGGCGAGG + Intronic
1171376109 20:24695049-24695071 GTCCGGAGCCGGCGCCGGCGAGG - Intergenic
1172272767 20:33663801-33663823 CCGCGAAGCCGGCCCCGCCGAGG + Exonic
1172474488 20:35226764-35226786 CGGCGGCGGCGGCCCCGGCGCGG - Exonic
1174231232 20:49046854-49046876 CGGCGAGGCCTGCCCGGGCGGGG + Intronic
1174343866 20:49915391-49915413 CGCCGAGGACGGCCCGGCCGAGG + Intronic
1175369988 20:58481725-58481747 GGCCGAAGCTGGAGCCGGCGGGG - Intronic
1175847011 20:62064811-62064833 CGGCCAACCCGGGCCCGGCGCGG - Exonic
1179626893 21:42653931-42653953 CGCCGGGGCCGGGCGCGGCGGGG + Intronic
1180699520 22:17774016-17774038 GGCCGAGGCCAGCCCCGGAGAGG - Exonic
1181934620 22:26429610-26429632 CGCCGCCGCCGCCCCCGCCGAGG + Intronic
1184039080 22:41932836-41932858 CGCAGAGGCCGACCCCTGCGCGG + Intergenic
1184820376 22:46905527-46905549 CCCTGCAGCCGGCCCCGGGGAGG + Intronic
1185023542 22:48394757-48394779 CAGCGAAGCCGGCCTCAGCGTGG + Intergenic
949351216 3:3126762-3126784 CGCCCCAGCGGGCCTCGGCGGGG + Intergenic
952241284 3:31533147-31533169 CGCCGAAGCCGGCCCCGGCGGGG + Exonic
954277954 3:49554656-49554678 CGGCGGCGCCGGCCCCGGCCCGG + Exonic
955228418 3:57079270-57079292 CGCCGCAGCCGCCGCCGCCGCGG - Exonic
956677997 3:71753588-71753610 CGCCGCCGCCAGCCCCGCCGAGG - Intronic
961234814 3:125357214-125357236 CGCCGCAGACGACCCCGCCGAGG + Intronic
963236740 3:142963700-142963722 CGCCGCCGCCGCCCCCGGAGCGG + Intergenic
966915832 3:184583721-184583743 CGCCGCAGCCGGCCCGGGGGAGG + Intronic
968213401 3:196868026-196868048 CCCCGCCGCCGGCCCCGTCGCGG - Exonic
968230728 3:197003267-197003289 CGCGAAGGCCGGGCCCGGCGTGG - Exonic
968691467 4:1992421-1992443 GGCCGAAGCAGGCCCTGGTGTGG - Intronic
968701374 4:2059642-2059664 CGCGGCGGCCGGCCCGGGCGCGG - Exonic
970202871 4:13627473-13627495 CCCCGGGGCTGGCCCCGGCGCGG - Exonic
981034236 4:140153231-140153253 CACCGATCCCGGCCCCGCCGAGG + Exonic
984734766 4:183099003-183099025 CGGCGACGCCGGCAGCGGCGGGG + Intergenic
984772158 4:183445139-183445161 CGCCGAGGCCGGTCCCGCGGAGG - Intronic
984778588 4:183504909-183504931 CCCCGGCGCCGGCCCCGCCGAGG + Intergenic
985247989 4:187995965-187995987 CGGCGAGGCCGGCTCCGGCCTGG - Intronic
985678933 5:1246073-1246095 CGCTGAAGCCGGCCGGAGCGGGG + Exonic
997582704 5:135027613-135027635 CGCCGAGGCAGCCCCCGCCGAGG - Intergenic
998406677 5:141878264-141878286 AGCCGCCGCCGGCCCCGGCCTGG + Exonic
1002029342 5:176416457-176416479 CGCCGACGCCGGCTCCCCCGCGG - Exonic
1002645059 5:180648964-180648986 CGCCGTCGCCGGCCACGGGGAGG + Intronic
1004424205 6:15496718-15496740 GGCCGAAGCGGGCCACGGCCGGG + Exonic
1007591153 6:43021672-43021694 CCCCGGCCCCGGCCCCGGCGCGG - Exonic
1015525968 6:134175516-134175538 CGCCGCCGCCGGCCCCGCTGGGG - Intronic
1016657937 6:146543355-146543377 CGCCGACCCCGGCCCCGGGGGGG + Intergenic
1019154239 6:170028669-170028691 CGCAGAACCCGGCCCTGGAGTGG - Intergenic
1019686013 7:2382661-2382683 CGCCAAAGCCAGGCCGGGCGTGG - Intergenic
1022094569 7:27130619-27130641 CGCAGACGGCGGCCCGGGCGGGG - Exonic
1023418147 7:39950845-39950867 CGCCGCAGCCGCCGCCGCCGCGG + Exonic
1023955631 7:44884874-44884896 CGCCGAAGCCGCCACCGCCGCGG + Exonic
1028567223 7:92246277-92246299 AGCCGAAGGCGCCCGCGGCGAGG - Exonic
1029699026 7:102234254-102234276 GGACGCAGCCGGCCCGGGCGGGG - Intronic
1032013567 7:128361649-128361671 CGGCGAAGCCGCCCGCGCCGGGG + Exonic
1038828463 8:31032890-31032912 CGGGGGAGCCGGGCCCGGCGTGG - Exonic
1040080275 8:43277033-43277055 GGTCGGAGCAGGCCCCGGCGGGG - Intergenic
1041552597 8:59118792-59118814 CCGCCAAGCCGGCCCCGCCGCGG + Intronic
1041696466 8:60741938-60741960 CACCGCAGCCGGCTCCGTCGGGG + Exonic
1049090753 8:140511788-140511810 CACCGAAGCGCGCGCCGGCGTGG - Intronic
1049212256 8:141392172-141392194 CCCCGAAGCCGTGCCCGGAGCGG - Intronic
1049411362 8:142475370-142475392 CGCCGAGGCCGGCCCGGGTGGGG - Intronic
1049759716 8:144326516-144326538 CGCCGCTGCGGGCCCCGACGTGG - Exonic
1053114611 9:35490123-35490145 CGCCGCCGCCGCCGCCGGCGCGG + Intronic
1056475175 9:86946299-86946321 CGGCGCGGGCGGCCCCGGCGCGG - Exonic
1056732571 9:89178496-89178518 TGCTGGTGCCGGCCCCGGCGCGG + Exonic
1059375199 9:113876088-113876110 CGGCGAGGCCGGCCCGGGGGCGG + Intergenic
1061128333 9:128690111-128690133 CCCAGAGGCTGGCCCCGGCGGGG + Intronic
1190024665 X:46912540-46912562 CGCGGGGGGCGGCCCCGGCGGGG + Exonic
1190024720 X:46912728-46912750 CGCGGAGGCCGGACCCGGCGCGG + Intronic
1190385635 X:49879960-49879982 CCCCGGCCCCGGCCCCGGCGCGG + Exonic
1190688847 X:52897235-52897257 CGCGGAAGGGGGCGCCGGCGAGG - Intronic
1190697136 X:52958557-52958579 CGCGGAAGGGGGCGCCGGCGAGG + Intronic
1198051632 X:132957454-132957476 CGCCGCAGCCGCCGCCGCCGTGG - Intronic