ID: 952241354

View in Genome Browser
Species Human (GRCh38)
Location 3:31533418-31533440
Sequence CCCCGCTCGCGTCCTGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 132}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952241344_952241354 16 Left 952241344 3:31533379-31533401 CCGCAGCTCTCCTCGACTTGGCC 0: 1
1: 0
2: 1
3: 15
4: 189
Right 952241354 3:31533418-31533440 CCCCGCTCGCGTCCTGGCTGAGG 0: 1
1: 0
2: 0
3: 10
4: 132
952241349_952241354 -7 Left 952241349 3:31533402-31533424 CCGCGCCGCCGCGGAGCCCCGCT 0: 1
1: 0
2: 2
3: 26
4: 321
Right 952241354 3:31533418-31533440 CCCCGCTCGCGTCCTGGCTGAGG 0: 1
1: 0
2: 0
3: 10
4: 132
952241339_952241354 26 Left 952241339 3:31533369-31533391 CCTCCGCCCGCCGCAGCTCTCCT 0: 1
1: 0
2: 0
3: 30
4: 376
Right 952241354 3:31533418-31533440 CCCCGCTCGCGTCCTGGCTGAGG 0: 1
1: 0
2: 0
3: 10
4: 132
952241340_952241354 23 Left 952241340 3:31533372-31533394 CCGCCCGCCGCAGCTCTCCTCGA 0: 1
1: 0
2: 0
3: 12
4: 119
Right 952241354 3:31533418-31533440 CCCCGCTCGCGTCCTGGCTGAGG 0: 1
1: 0
2: 0
3: 10
4: 132
952241345_952241354 6 Left 952241345 3:31533389-31533411 CCTCGACTTGGCCCCGCGCCGCC 0: 1
1: 0
2: 2
3: 21
4: 199
Right 952241354 3:31533418-31533440 CCCCGCTCGCGTCCTGGCTGAGG 0: 1
1: 0
2: 0
3: 10
4: 132
952241348_952241354 -6 Left 952241348 3:31533401-31533423 CCCGCGCCGCCGCGGAGCCCCGC 0: 2
1: 0
2: 9
3: 82
4: 651
Right 952241354 3:31533418-31533440 CCCCGCTCGCGTCCTGGCTGAGG 0: 1
1: 0
2: 0
3: 10
4: 132
952241347_952241354 -5 Left 952241347 3:31533400-31533422 CCCCGCGCCGCCGCGGAGCCCCG 0: 1
1: 1
2: 3
3: 57
4: 450
Right 952241354 3:31533418-31533440 CCCCGCTCGCGTCCTGGCTGAGG 0: 1
1: 0
2: 0
3: 10
4: 132
952241341_952241354 20 Left 952241341 3:31533375-31533397 CCCGCCGCAGCTCTCCTCGACTT 0: 1
1: 0
2: 0
3: 7
4: 166
Right 952241354 3:31533418-31533440 CCCCGCTCGCGTCCTGGCTGAGG 0: 1
1: 0
2: 0
3: 10
4: 132
952241342_952241354 19 Left 952241342 3:31533376-31533398 CCGCCGCAGCTCTCCTCGACTTG 0: 1
1: 0
2: 0
3: 7
4: 98
Right 952241354 3:31533418-31533440 CCCCGCTCGCGTCCTGGCTGAGG 0: 1
1: 0
2: 0
3: 10
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952241354 Original CRISPR CCCCGCTCGCGTCCTGGCTG AGG Intronic
900531075 1:3153481-3153503 CCCCGCTCTGGTCCAGCCTGGGG - Intronic
900985105 1:6068718-6068740 CCCCTCTTGCACCCTGGCTGTGG - Intronic
903846000 1:26280281-26280303 CCCCGCCCCCGTCCTGGGGGTGG - Intronic
907682710 1:56579086-56579108 CCCGGGTCGCCTCCTGGCCGAGG + Exonic
908127171 1:61043387-61043409 CCCCGCTGCCGTCGTGGCTTGGG - Intronic
910437627 1:87221074-87221096 CCCCTTTCAAGTCCTGGCTGAGG + Intergenic
915525852 1:156475836-156475858 CCCCGCCCCACTCCTGGCTGGGG + Intronic
915902094 1:159854706-159854728 CCGCGCCCTCCTCCTGGCTGGGG + Exonic
920381451 1:205536780-205536802 CCCTGCTCCCGCCCTAGCTGTGG + Intergenic
920729991 1:208474395-208474417 CCACACTCGCGTCCTGGAAGAGG - Intergenic
921692291 1:218164990-218165012 CGCCGTTCGCGTCCCCGCTGGGG - Intergenic
922280040 1:224114575-224114597 TCCCGATTGCGTCCTAGCTGCGG + Intronic
922884216 1:229005735-229005757 CCCCGCTCCACTCTTGGCTGTGG - Intergenic
924561171 1:245156863-245156885 CCCCCCGGGCGGCCTGGCTGAGG - Intronic
1063092190 10:2875133-2875155 CCCCGCTTCTGTCCTGGCTCAGG - Intergenic
1068388339 10:56360370-56360392 CCCCTCCAGGGTCCTGGCTGAGG - Exonic
1071201300 10:83222579-83222601 CTCCTCTCCCTTCCTGGCTGGGG - Intergenic
1072169934 10:92848925-92848947 CCGCGTTCTCCTCCTGGCTGCGG + Intronic
1072721273 10:97782395-97782417 CCCCTCTCCTCTCCTGGCTGGGG - Intergenic
1073217291 10:101843580-101843602 CCCCGCTCCCGCCCGGGCCGTGG + Intronic
1075264647 10:120990140-120990162 CCCCCCTCCCCTCCTGGCTGGGG + Intergenic
1075369974 10:121927759-121927781 GCCCCCTCGCGTCCTCGCTGGGG + Intronic
1077334233 11:1996405-1996427 CCCAGCTGGAGACCTGGCTGTGG + Intergenic
1077414343 11:2417862-2417884 CTCTGCCCCCGTCCTGGCTGAGG - Intronic
1079023142 11:16925149-16925171 CCCCGCAGGCGTGCGGGCTGCGG - Intronic
1085023611 11:73223994-73224016 CCCCCCTAGGATCCTGGCTGTGG - Intronic
1085284563 11:75351522-75351544 CCCCGCCCGTGTCCTCGCCGAGG + Intronic
1086489923 11:87348990-87349012 CCCAGCTATCTTCCTGGCTGAGG - Intergenic
1089191402 11:116656154-116656176 CCCTGCTGGAGTTCTGGCTGTGG - Intergenic
1202817216 11_KI270721v1_random:51587-51609 CCCAGCTGGAGACCTGGCTGTGG + Intergenic
1091711260 12:2742188-2742210 CACCGCTCGCTTTCTGGATGTGG + Intergenic
1092216781 12:6689128-6689150 CCCCTCCCGCGCCCTGGCTCAGG - Intronic
1097232811 12:57522698-57522720 CCCCTCTCCCGTCCGGGCAGCGG + Intronic
1097962353 12:65545073-65545095 CCTCGCTAGCATCCTGACTGGGG + Intergenic
1104767677 12:131340964-131340986 CCCCGCTGAGGTGCTGGCTGGGG - Intergenic
1104778319 12:131404161-131404183 CCCCACCTGTGTCCTGGCTGGGG - Intergenic
1104812033 12:131625118-131625140 CCCCGCTGAGGTGCTGGCTGGGG + Intergenic
1104917732 12:132274480-132274502 CCCTGCTCTCCTGCTGGCTGGGG + Intronic
1105000599 12:132687675-132687697 CGCCGGCCGCGTCCAGGCTGCGG + Exonic
1105502881 13:20988336-20988358 CCCCGCCCCCGCCCCGGCTGCGG - Exonic
1107111678 13:36704687-36704709 CCCCCCACGCATCCTTGCTGAGG - Intergenic
1112065688 13:95790406-95790428 CCCCGCTCCCCTCATGTCTGAGG + Intronic
1115721171 14:36162493-36162515 CCCCGTGCGCTTCCTGGGTGAGG + Intergenic
1122310660 14:100792176-100792198 CCCTGCTGGCGCCATGGCTGGGG + Intergenic
1122641889 14:103164889-103164911 CCCCCCTCCCTTCCTGGCTGGGG + Intergenic
1124515262 15:30362439-30362461 CCTCGCTTTCGTCCTGGCAGCGG + Exonic
1124636077 15:31366013-31366035 CTCCGCTCGCGGCCTCGCTGTGG + Intronic
1124727660 15:32168290-32168312 CCTCGCTTTCGTCCTGGCAGCGG - Exonic
1125364787 15:38902244-38902266 CCCCGCCCACGTCCTGGATATGG - Intergenic
1129326080 15:74800910-74800932 CCCCACTCACGTCATGACTGAGG - Exonic
1129658377 15:77539670-77539692 CCCTGGACGCGTCATGGCTGTGG + Intergenic
1132671307 16:1103212-1103234 CCCCGCCCCGGCCCTGGCTGTGG - Intergenic
1132713304 16:1278710-1278732 CCCCGCCAGCCTCCAGGCTGGGG - Intergenic
1133220197 16:4316355-4316377 CCCCGCTCGCGTCCGCGCCCCGG + Intronic
1133415088 16:5600267-5600289 TCTCGCTCTCGTCCAGGCTGGGG - Intergenic
1133768339 16:8853252-8853274 GCCCTCTCGGGTCTTGGCTGTGG + Exonic
1137988792 16:53131493-53131515 CCCCGCGCCTGTCATGGCTGCGG + Intronic
1138692924 16:58785792-58785814 CCCCTTGCGCTTCCTGGCTGAGG + Intergenic
1141751729 16:85962708-85962730 CCCCGGGGGCGTCCTGGCTTTGG + Intergenic
1141956684 16:87376722-87376744 CCCACCTGGCGTCCTGGCAGAGG - Intronic
1142222448 16:88862189-88862211 TCCTGCCCGAGTCCTGGCTGTGG + Exonic
1142638283 17:1270971-1270993 CCCCGCGCGCGGCCGGGCCGTGG - Exonic
1144761781 17:17711206-17711228 CTCTGGTCACGTCCTGGCTGGGG + Intronic
1148157201 17:45431218-45431240 CCCCGCTCCCGCCCGGGCTTCGG + Intronic
1148262365 17:46194089-46194111 CCCGGCGCGGGCCCTGGCTGGGG - Intronic
1150283167 17:63940995-63941017 CCCCGCTGCCGTCGTGGCTGTGG + Exonic
1151726600 17:75888684-75888706 TCCTGCCCGCCTCCTGGCTGTGG + Intronic
1151801524 17:76382461-76382483 CCCAGCTCCCCTCCTGGCTCTGG - Intronic
1151942761 17:77302954-77302976 CCCCGCTCGTCTCCTGTCTTCGG + Intronic
1152364813 17:79849515-79849537 CCCAGCTAGGGTCCTGCCTGTGG - Intergenic
1152546821 17:81004320-81004342 CCCCCCGCCCTTCCTGGCTGCGG + Intronic
1152720240 17:81920035-81920057 CCCCACTTTTGTCCTGGCTGTGG - Exonic
1157815863 18:50729200-50729222 CCTCGCTGGCGTCCTGGCACCGG - Exonic
1160727195 19:622548-622570 ACCCCCTCTCCTCCTGGCTGGGG - Intronic
1161057941 19:2200026-2200048 CCTCGCTCCTGTGCTGGCTGTGG + Intronic
1161353150 19:3804683-3804705 CCCTGCTGACATCCTGGCTGTGG + Exonic
1162490453 19:10988068-10988090 CCCTGCTCCCACCCTGGCTGCGG + Intronic
1165096554 19:33412869-33412891 CCCCACATGCGTCCTGGCTGTGG - Intronic
1166147651 19:40848535-40848557 ACCCGCGCGCGTTCTGCCTGGGG - Intronic
1166151792 19:40880400-40880422 ACCCGCGCGCGTTCTGCCTGCGG - Intronic
1166170693 19:41025930-41025952 ACCCGCGCGCGTTCTGTCTGGGG - Intergenic
1166219153 19:41353966-41353988 CCCCGTGCGCTTCCTGGGTGGGG - Intronic
1167441638 19:49512717-49512739 CCTCGCTCCCTTCCTGCCTGCGG - Exonic
1168108802 19:54180686-54180708 CCCCGCTCTCCTCCCGGCTAGGG + Intronic
1168495012 19:56840540-56840562 CCCCGCGCGCCTCCTGCCCGCGG - Intronic
931199182 2:60080548-60080570 CCCCACTCGCATCCTGGCCCTGG + Intergenic
931762451 2:65430662-65430684 CCCCGCGCGCGTCTTTGCAGGGG - Intronic
932874948 2:75441835-75441857 CCTCACTCGAGTCCTGGCTTTGG - Intergenic
938379286 2:130827507-130827529 CCCCGCTCTGCTCCTCGCTGGGG + Intergenic
941188373 2:162344757-162344779 CCCCGCTCGCCCCCAGGCGGGGG + Intronic
942619786 2:177834540-177834562 CCCCACTCCCCTCCTGTCTGGGG + Intronic
1173221715 20:41137351-41137373 CCCCGCCTGCGGCCTGTCTGGGG + Intronic
1174506895 20:51022947-51022969 CCCCTCTCGCGTCCTCGCCCCGG - Exonic
1175443848 20:59007381-59007403 CCCCGCTCCCTCCCTGGCTCCGG + Intergenic
1176078953 20:63262158-63262180 CCCCGGCCGCGTCCTGGCTTTGG + Intronic
1184086626 22:42269895-42269917 CCGCGCTCGCCTCTTGGCTACGG - Intronic
1184834783 22:47014755-47014777 CCGCGCTGGAGCCCTGGCTGAGG - Intronic
1185190662 22:49433912-49433934 CCCTGCTAGCCTCCTGGCCGTGG + Intronic
1185333213 22:50260826-50260848 CACCGCGGGCTTCCTGGCTGGGG + Intronic
1203252528 22_KI270733v1_random:124856-124878 CCGCGCGTGCGTCCCGGCTGCGG + Intergenic
952241354 3:31533418-31533440 CCCCGCTCGCGTCCTGGCTGAGG + Intronic
954774359 3:53002886-53002908 CCGCTCTCTGGTCCTGGCTGAGG + Intronic
956499409 3:69865959-69865981 CCCAGCTCCGGTACTGGCTGAGG - Intronic
958955998 3:100466537-100466559 CCCTGCTCCCCTCCTGGCTGGGG + Intergenic
969248558 4:5952528-5952550 CACCGCTCCCCACCTGGCTGCGG + Intronic
969466148 4:7357735-7357757 ACCCACTCGGGGCCTGGCTGGGG + Intronic
969695124 4:8729873-8729895 CCTTGCTGGCGGCCTGGCTGGGG + Intergenic
972784680 4:42315478-42315500 CCCCTCTCTCGGGCTGGCTGAGG - Intergenic
984330484 4:178309255-178309277 ACCCCCTTGGGTCCTGGCTGAGG - Intergenic
988708764 5:33752822-33752844 CCCCTCTTGCCTCCTGACTGTGG - Intronic
993900945 5:93584187-93584209 CTCCGCTCGCGCTCCGGCTGCGG + Exonic
998157742 5:139796011-139796033 CCCCGCTGGCGGCCAGGCCGGGG + Intronic
999326857 5:150649258-150649280 CCCCTCTGGCTTCCTGGGTGAGG + Exonic
999462923 5:151772219-151772241 TCCCGCTCCCGTCCCGGCTGGGG + Intronic
999727270 5:154446816-154446838 CCCCGCTCGCGTCTGGGCCCCGG + Intronic
1002691279 5:181052654-181052676 CCCCGGCCACGTCCTGCCTGCGG + Intronic
1006502370 6:34466749-34466771 CCCCGCTCCCATCCCAGCTGTGG - Intronic
1015525989 6:134175608-134175630 CCCGGCTCGAGTCCCTGCTGCGG - Intronic
1015880487 6:137866708-137866730 GCCCGCCCGGGTCCTGTCTGGGG + Intergenic
1019320438 7:412920-412942 CACCGCGCCCGGCCTGGCTGTGG - Intergenic
1020003224 7:4767355-4767377 CCCTGCGGGCGGCCTGGCTGCGG + Exonic
1022655845 7:32318834-32318856 CACGGCTCACTTCCTGGCTGGGG + Intergenic
1026778195 7:73245049-73245071 CACAGCTGGCGTCCTGGCAGCGG - Intergenic
1026978354 7:74512496-74512518 CCCCTCTCAAGTCCTGGATGAGG - Intronic
1027068980 7:75147494-75147516 CACAGCTGGCGTCCTGGCAGCGG + Intronic
1032250949 7:130256780-130256802 CCCTGCTCCCTTCCTGGCTGGGG + Intergenic
1041044959 8:53880306-53880328 CCCCGCTCGGTTGCTGGGTGGGG + Intronic
1042216357 8:66432536-66432558 CCCGGGTCGCGTACTTGCTGAGG + Exonic
1045023569 8:98064744-98064766 CGCCGCCCGCGCCCGGGCTGGGG + Intronic
1048749057 8:137650244-137650266 CCCCCATCCTGTCCTGGCTGAGG + Intergenic
1049328054 8:142034312-142034334 CCTTGCTCTCCTCCTGGCTGTGG - Intergenic
1060979690 9:127785341-127785363 CCGCGCTCGGCACCTGGCTGCGG - Intergenic
1060984814 9:127813874-127813896 CCCCGCCTGCCTCCTGGCTCAGG + Exonic
1061179302 9:129014373-129014395 CCCCGCTGGCCTCCTGGCCCAGG - Intronic
1061478570 9:130885041-130885063 CCCCGGCCGCCTCCTGGCTCGGG - Exonic
1061737182 9:132669809-132669831 CCCCACCCGCGGCCCGGCTGTGG - Intronic
1062378413 9:136275293-136275315 CCCAGCTCCGGTCCCGGCTGGGG + Intergenic
1062543893 9:137053384-137053406 CCACTCTCGTGTCCTGGCGGGGG + Intronic
1185610715 X:1392424-1392446 GCCCGCTCGGGTACTGGCAGCGG - Exonic
1187325094 X:18278931-18278953 CCCTGCTCCCGCCCTGGCTCAGG - Intronic
1188762904 X:34054202-34054224 TCCCCCTCTCCTCCTGGCTGGGG + Intergenic
1189354226 X:40299089-40299111 CCCCGCCCCCGCCCGGGCTGTGG - Intergenic
1189446686 X:41086382-41086404 CCCCCTTCCCGTCCTGTCTGGGG + Intronic