ID: 952241943

View in Genome Browser
Species Human (GRCh38)
Location 3:31540062-31540084
Sequence CACCTATGTTTGCTGTAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952241943 Original CRISPR CACCTATGTTTGCTGTAGAA GGG Intronic
900572567 1:3365740-3365762 CACCTTTGGCTGCTGCAGAATGG - Intronic
900589703 1:3454247-3454269 GACCGATGTTTGCTGTAGAAAGG - Intergenic
903343920 1:22672571-22672593 CAGCTATGTCTTGTGTAGAATGG + Intergenic
912306038 1:108568572-108568594 CACCTGTTTTTGATTTAGAATGG + Intronic
918834368 1:189441192-189441214 AACTAATATTTGCTGTAGAAGGG - Intergenic
920971476 1:210746897-210746919 CACCAAGGTTTTCTGCAGAATGG + Intronic
922559374 1:226557956-226557978 CACCAAAGTTAGGTGTAGAAAGG + Intronic
922892500 1:229072659-229072681 CACCTTTGTTTCCAGCAGAAAGG - Intergenic
1067976684 10:51033735-51033757 GAGCTATGTTTGCAGAAGAAAGG + Intronic
1075026801 10:118991137-118991159 CACCTGTGTCTGCTGCAGACAGG - Intergenic
1076150432 10:128157871-128157893 CATCTATGTTTGCTGTGGCATGG + Intergenic
1077741060 11:4846099-4846121 CTCCCATGTTTGCTGCAGCATGG + Intronic
1080198380 11:29638574-29638596 CAGCTATTTTTCCTGTAAAATGG + Intergenic
1088259768 11:107933152-107933174 TAGCAATGTTAGCTGTAGAATGG + Intronic
1088728206 11:112657865-112657887 GACCTATTTTCTCTGTAGAAGGG + Intergenic
1093082847 12:14833337-14833359 CAGCTATATTTGTTGAAGAATGG + Intronic
1093169445 12:15843361-15843383 CAAGTATGTTTGCTTTTGAATGG + Intronic
1093960123 12:25263474-25263496 CACTTATGATTTCTGAAGAAGGG - Intergenic
1094551428 12:31455400-31455422 CTCCTATGTCTGCTTAAGAAGGG + Intronic
1097575099 12:61382643-61382665 CACCCAAGTTTGCTTTTGAAAGG + Intergenic
1105228076 13:18456531-18456553 CACATATATTCTCTGTAGAAGGG - Intergenic
1105945536 13:25186524-25186546 CACCTGTGTCAGCTGCAGAAAGG - Intergenic
1109155032 13:58899018-58899040 CCCCTATCTTTGCTCTGGAAGGG - Intergenic
1109159286 13:58951895-58951917 CTCCTATGGTTGCTGGAGGAAGG - Intergenic
1109997721 13:70151438-70151460 CATCTATTTTTGCTGTAAATGGG + Intergenic
1111053965 13:82923549-82923571 CACCTACGATTGCTGTCAAAGGG + Intergenic
1115605229 14:34994319-34994341 CTCCTGTGTATTCTGTAGAAGGG + Intronic
1116030786 14:39568713-39568735 CAACTCTGATTGCTTTAGAATGG - Intergenic
1118309619 14:64682744-64682766 CACCTTTCTCTGCTGGAGAAAGG + Intergenic
1119506809 14:75180270-75180292 CTCCTCTGTATGCTGTGGAATGG + Intergenic
1125057964 15:35385316-35385338 CACGTATGTTTACTGCAGCACGG + Intronic
1125177393 15:36840159-36840181 AACATATTTTTGCTTTAGAAAGG - Intergenic
1125712697 15:41799697-41799719 CACCCATGTTTTCAGGAGAATGG - Intronic
1126575699 15:50194214-50194236 CTCCTATGGGAGCTGTAGAAGGG + Intronic
1129257677 15:74343343-74343365 CACCTCTGTTATCTGTAAAATGG - Intronic
1129980226 15:79862595-79862617 TACCTCTTTTTGCTGTAGAAAGG - Intronic
1131406422 15:92168629-92168651 CACCTAAGACTGCTGTAGCATGG + Intronic
1133663577 16:7943000-7943022 CTCATATGTTTTCTGTGGAAGGG + Intergenic
1137005625 16:35272422-35272444 AACCTATCTTTGCTTTTGAATGG - Intergenic
1137984882 16:53099334-53099356 CACCTTTGTGTGCTGTACCAGGG + Intronic
1139638586 16:68274687-68274709 CACCTGTGTTTGCTGTGGCCTGG - Exonic
1143630618 17:8137895-8137917 TTGCTCTGTTTGCTGTAGAAGGG + Intergenic
1145038826 17:19561308-19561330 CACCTATGGTTGTTGCAGCAGGG + Intronic
1150698515 17:67426836-67426858 CACATTTGTTTCCTGTAAAATGG + Intronic
1151101357 17:71559202-71559224 CATTTATATTTGCAGTAGAATGG - Intergenic
1151153533 17:72108409-72108431 CACCAGTGTTTGCTGTACCAAGG + Intergenic
1152290771 17:79438770-79438792 CACCTGCGTTTCCTCTAGAAGGG + Intronic
1154525305 18:15282944-15282966 CACATATATTCTCTGTAGAAGGG + Intergenic
1157417966 18:47521712-47521734 CACCTATTTAAGCTGTAGAGGGG + Intergenic
1164063243 19:21693275-21693297 AACCTATCTTTGCTTTTGAATGG - Intergenic
1165253089 19:34556220-34556242 AACCTATCTTTGCTTTTGAATGG - Intergenic
1165407286 19:35638597-35638619 CACAGATGTGCGCTGTAGAAAGG + Intergenic
926018239 2:9473539-9473561 CACCTTTGCTTGCTCTAGCAGGG + Intergenic
928212250 2:29331970-29331992 CACTTATGTTTTCTGTGGCAGGG - Intronic
928446102 2:31334717-31334739 CCCTTATGTTTGCAGTAAAATGG + Exonic
930853870 2:55991321-55991343 CAGCTATCTTGGCTGTGGAATGG + Intergenic
933903950 2:86870785-86870807 AACCTATGTTTTTTGTAGATTGG + Intergenic
935312108 2:101794935-101794957 CTCCTATATTTCCTGTAGACTGG + Intronic
938524490 2:132115067-132115089 CACATATATTCTCTGTAGAAGGG + Intergenic
940954241 2:159711048-159711070 AACCTAGGTTTCCTGTAAAACGG - Intergenic
944180609 2:196888495-196888517 CCCCTATGTTTTCTGTAAACTGG - Intronic
944383502 2:199139176-199139198 CACCTATTAGAGCTGTAGAATGG - Intergenic
947558074 2:231115986-231116008 CACCTAAGTTTCCTGTTGTAGGG + Intronic
1170420279 20:16185824-16185846 CATCCATGTTTGCTGTAAAAAGG + Intergenic
1174265754 20:49330686-49330708 CTCCTCTGTTTGATCTAGAAAGG + Intergenic
1176772124 21:13085546-13085568 CACATATATTCTCTGTAGAAGGG - Intergenic
1177829556 21:26122174-26122196 CACCTATGTTGGTTTTACAATGG - Intronic
951112920 3:18825850-18825872 CACATATGATTGATGTAGAGAGG + Intergenic
951263095 3:20535129-20535151 CACCTGTGTTTGCTGTGGAATGG - Intergenic
951265560 3:20561722-20561744 TATTTATGTTTGATGTAGAAAGG - Intergenic
952241943 3:31540062-31540084 CACCTATGTTTGCTGTAGAAGGG + Intronic
955017501 3:55086706-55086728 CACCTGTCTTAGCTGTAGAGGGG + Intergenic
956281214 3:67559152-67559174 CACGTATGTTAGCTGTAGAAGGG - Intronic
957439963 3:80232877-80232899 GACTAATGTTTGCTGAAGAAGGG - Intergenic
959063659 3:101636927-101636949 AACCTATCTTTGCTTTTGAATGG + Intergenic
964677325 3:159298150-159298172 CATCTATGTGAGCTGTAGAATGG - Intronic
964854531 3:161132016-161132038 CATCTATATTTCCTGTAAAATGG - Intronic
966435865 3:179883305-179883327 CACTTCTATTTGCTGTAGCAGGG + Intronic
968492931 4:900139-900161 CGTCTCTGTTGGCTGTAGAATGG - Intronic
968492945 4:900223-900245 CGTCTCTGTTGGCTGTAGAATGG - Intronic
969897216 4:10316722-10316744 GACCTATGTTTGAGGTAGAAAGG + Intergenic
970032249 4:11689479-11689501 CGCCTATGTTAGCTAAAGAAAGG - Intergenic
970661281 4:18288351-18288373 CACCAAGGTTTCCTGCAGAAGGG + Intergenic
974892797 4:67901841-67901863 CTCCCATGTTTGTTGTAGCATGG - Intergenic
976879623 4:89903949-89903971 CACCTATGTGTGCAGTTAAAAGG + Intronic
982834175 4:160102730-160102752 CCCCTATGTTCACTGTAGCATGG - Intergenic
986194845 5:5528274-5528296 CACTTACTTTTGCTTTAGAAGGG - Intergenic
987005461 5:13705403-13705425 AAGATATGTATGCTGTAGAATGG - Intronic
987201059 5:15578723-15578745 CACCTGTGTTTGCTTCAGAATGG - Intronic
987925416 5:24335096-24335118 CACCTATATCTGCTCTGGAAAGG + Intergenic
990969241 5:61484916-61484938 AACCTATTTCTCCTGTAGAATGG + Intronic
996432118 5:123392806-123392828 CACCAATGTTTGCTTTTAAATGG + Intronic
998827751 5:146121524-146121546 CACATATGTTTACTGCAGCACGG + Intronic
998975470 5:147641440-147641462 CCCCTAGGTTTGATGTAGAAAGG - Intronic
1001042393 5:168346157-168346179 TACCTATGTCTGATGTCGAAAGG + Intronic
1008156766 6:48025144-48025166 CACTGATGTTTGCTCAAGAATGG + Intronic
1009437848 6:63637486-63637508 CACCTTTTTGTGCTGTGGAAGGG - Intronic
1010808075 6:80262194-80262216 AACCTATGGTAGCTGTGGAAGGG + Intronic
1013688776 6:112615967-112615989 CAGCTCAGTTTTCTGTAGAATGG + Intergenic
1014480532 6:121930654-121930676 CAAAAGTGTTTGCTGTAGAAGGG - Intergenic
1014867820 6:126553437-126553459 CAACCATATTTACTGTAGAAAGG - Intergenic
1016308945 6:142713197-142713219 CACTTATGTTTGCTGAGAAAGGG - Intergenic
1017298530 6:152828918-152828940 AATCTATGTTTGCTATATAAAGG + Intergenic
1019116514 6:169768419-169768441 CATGTATTTGTGCTGTAGAACGG + Intronic
1022358976 7:29641521-29641543 AACCTATCTTTGCTTTTGAATGG - Intergenic
1023550522 7:41365675-41365697 CACTTATGTTTATTGTAGCAAGG + Intergenic
1028723170 7:94057634-94057656 CATCTAGGTATGCTGAAGAATGG + Intergenic
1030306239 7:108021397-108021419 CACTTATTTTTACTTTAGAAGGG + Intergenic
1033057245 7:138068960-138068982 CACCCATGTTGGCTGAAGATGGG - Intronic
1036684769 8:10902375-10902397 CACCTCTGCTTCCTGTGGAATGG - Intronic
1037099011 8:15019613-15019635 GACCTGTGTTTGCTGGACAAAGG + Intronic
1037992415 8:23330417-23330439 AACCTCTGTTTTCTGTAGAATGG + Intronic
1038501251 8:28046062-28046084 AGCCCATGCTTGCTGTAGAAAGG + Intronic
1039419570 8:37424888-37424910 CAACAATGTCTGCTGTAGACTGG - Intergenic
1041128735 8:54673158-54673180 CAACTATCTTATCTGTAGAAAGG + Intergenic
1041898811 8:62958106-62958128 CAACTTTGTCTTCTGTAGAACGG - Intronic
1047150699 8:122259095-122259117 CAGGTATGTTTGCTGTATTAAGG - Intergenic
1048725613 8:137380215-137380237 CACCTATATTGGCTGTGGAGTGG + Intergenic
1048882981 8:138885435-138885457 CACCTAGACTTGATGTAGAATGG - Intronic
1049992845 9:1006328-1006350 CCCCCATGTTTCCTGTAGAGTGG + Intergenic
1051067717 9:13124784-13124806 CAGCTTTCTTTTCTGTAGAATGG - Intronic
1052407577 9:28081698-28081720 CACCTTCTTTTGCTGTAAAATGG + Intronic
1060324752 9:122603106-122603128 CCCCTATGTTTAATGCAGAAGGG - Intergenic
1061137132 9:128741416-128741438 CACCCATGCTTCCTGGAGAAGGG - Intronic
1186357356 X:8801527-8801549 CACCCATATTTGCTGTGGACTGG + Intergenic
1187001747 X:15187842-15187864 CCCCTATGTTTCCTGTAAACTGG - Intergenic
1191963873 X:66734518-66734540 CAACTATGTTTCCTGTAGCTTGG + Intergenic
1196018170 X:110961481-110961503 CATCTAGGTTTGAGGTAGAAGGG - Intronic
1200782779 Y:7231908-7231930 CACCCAAGTCTGCTGTTGAATGG - Intergenic
1201282969 Y:12357076-12357098 AACCTATCTTTGCTTTTGAATGG - Intergenic