ID: 952242951

View in Genome Browser
Species Human (GRCh38)
Location 3:31552712-31552734
Sequence CTGTCCAAAGGACTCGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 78}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952242951_952242955 -4 Left 952242951 3:31552712-31552734 CCATCCACGAGTCCTTTGGACAG 0: 1
1: 0
2: 0
3: 5
4: 78
Right 952242955 3:31552731-31552753 ACAGTAAGCTTTGTGAGGACAGG 0: 1
1: 1
2: 9
3: 85
4: 542
952242951_952242954 -9 Left 952242951 3:31552712-31552734 CCATCCACGAGTCCTTTGGACAG 0: 1
1: 0
2: 0
3: 5
4: 78
Right 952242954 3:31552726-31552748 TTTGGACAGTAAGCTTTGTGAGG 0: 1
1: 0
2: 0
3: 25
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952242951 Original CRISPR CTGTCCAAAGGACTCGTGGA TGG (reversed) Intronic
902761182 1:18581645-18581667 CTGTCCAAAGAGCTCTTGGGCGG - Intergenic
904538101 1:31214759-31214781 CTGTGCAAAGGTCCTGTGGAGGG + Intronic
907337865 1:53712175-53712197 CTGTGCAAAGGCCTGGTAGAAGG - Intronic
914935320 1:151974184-151974206 ATGTGCAAAGGACTGGAGGAGGG + Intergenic
915642471 1:157239479-157239501 CTTACCAAAGGACTTGTGGTTGG + Intergenic
918761765 1:188419508-188419530 CTCTCCAGAGGACTCAGGGAAGG + Intergenic
920108624 1:203571842-203571864 CTGTCCCAAGGTTTCGTGGCTGG + Intergenic
922495590 1:226054963-226054985 TTGTCCCAAGGCCTCATGGAGGG - Intergenic
923758150 1:236812770-236812792 CAGGCCAAAGGACTTCTGGATGG + Exonic
1064403872 10:15043158-15043180 CTGACTAAAAGACACGTGGATGG - Intronic
1067186210 10:44030122-44030144 CTGTCTAAAGGACTGCTTGAAGG - Intergenic
1075948530 10:126458029-126458051 CTGTCTAAAGACCTCGGGGAAGG - Intronic
1076220632 10:128730566-128730588 CTCCCCAAAGGACTCTTGGCAGG - Intergenic
1076252841 10:128997131-128997153 CTGTCCTTAGGACTCGGGGAGGG + Intergenic
1084398477 11:68930126-68930148 CTGTTCACAGGCCTCGTGTAAGG - Intronic
1089325998 11:117657464-117657486 CTGACAAAAGGACTTGTGGCAGG - Intronic
1089868704 11:121654032-121654054 CTGACCAACGGACTTGTAGATGG + Intergenic
1090097940 11:123762331-123762353 ATGTCCTAGGGATTCGTGGAAGG - Intergenic
1091877404 12:3947280-3947302 ATGTACAAAGGGCCCGTGGAAGG - Intergenic
1092936278 12:13367102-13367124 CTGTCCATTGGACTGGGGGAAGG + Intergenic
1103605551 12:122083384-122083406 CTATACAAAGCATTCGTGGAGGG - Intronic
1104584041 12:130033326-130033348 CTGTCTAAGGGGCTCTTGGATGG + Intergenic
1106286358 13:28321225-28321247 CTGCCCAAAGGACAGGTGGGAGG + Intronic
1116048295 14:39771900-39771922 CTGTCCAAAGGAAATGTAGATGG + Intergenic
1124374599 15:29122164-29122186 CTGCACAAAGTTCTCGTGGATGG + Exonic
1128568684 15:68717988-68718010 CTTGCCAAAGGACTCCTAGATGG + Intronic
1132236875 15:100228778-100228800 CTGTCCAATGGTCTGGGGGAAGG + Intronic
1133345356 16:5066067-5066089 CTGGGCAAAGGACTCTGGGAAGG + Exonic
1133974123 16:10588280-10588302 TCGTGCAAAGGCCTCGTGGATGG + Intergenic
1135220742 16:20612294-20612316 CTGGCCAAAGGACGCCTGGGAGG + Intronic
1135528908 16:23235667-23235689 CTGTCCAATAGATTCCTGGAAGG + Intergenic
1141636021 16:85314305-85314327 CTTTCCAAGGGACTCCTGGGAGG - Intergenic
1148580374 17:48739196-48739218 CTGCCCCAAGGACCCCTGGAGGG - Intergenic
1152102611 17:78311396-78311418 CTGTCCAAAGGAACACTGGAAGG - Intergenic
1152927357 17:83093384-83093406 CTGTCCCCAGGGCTGGTGGAGGG - Intronic
1153029878 18:703699-703721 CTGTCCAAAAGGCTCAGGGAAGG - Intronic
1155777425 18:29782770-29782792 CCTTCCAAAGGAGTCTTGGAAGG + Intergenic
1157286262 18:46379443-46379465 CTGTAAAATGGACTCGGGGAGGG - Intronic
1157519015 18:48332287-48332309 CTGAGCCAAGGACTTGTGGAAGG - Intronic
1161383169 19:3977210-3977232 CTCACCAAAGGACTCGTTGACGG + Exonic
926287932 2:11505405-11505427 CTGTCCAGAGGACCAGTGGCTGG - Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
942060585 2:172225317-172225339 CTGTCATAAGGACTGGGGGATGG - Intergenic
948448891 2:238056469-238056491 ATGACCAAAGGACCCCTGGAAGG + Intronic
948603668 2:239121480-239121502 CTGTTCCAAGGGCTCTTGGATGG + Intronic
1171321536 20:24248709-24248731 CTGGCCAAAAGACTAGTGAATGG + Intergenic
1172177260 20:32979991-32980013 CTGTCCAGGGGTCTCGTGCAGGG + Intergenic
1179505792 21:41839498-41839520 GTGTAGAAAGGCCTCGTGGAAGG - Intronic
1180252655 21:46599369-46599391 ATGTTCAAAGAACTCGTGGCAGG + Exonic
1182465831 22:30515582-30515604 ATGTCCAAAGGCCTTGTGGTAGG - Intergenic
1183904613 22:41031085-41031107 CTGACCACAGGAGTCTTGGACGG + Intergenic
1184599096 22:45532185-45532207 CTGTCCAGGGGCCTGGTGGAGGG + Intronic
950674909 3:14548855-14548877 CTGTGCAAAGGGCTCAAGGAGGG - Intergenic
952242951 3:31552712-31552734 CTGTCCAAAGGACTCGTGGATGG - Intronic
952729233 3:36621350-36621372 GTGTGCAAAGGACGCATGGAGGG - Intergenic
953971079 3:47347498-47347520 TTGTCCATTGGACTCCTGGATGG + Intergenic
954403873 3:50334303-50334325 GTATCCAAAGGTCTCCTGGATGG + Intronic
959783435 3:110264608-110264630 CTGGTCAAAGGATTTGTGGAAGG + Intergenic
967486211 3:190034174-190034196 CTGTCCAAAGGACTAGATAAAGG + Intronic
981160732 4:141495643-141495665 CTGTCCATAGAACTCTTTGAGGG - Intergenic
982046770 4:151455507-151455529 CTTTCCAAAGGAACCATGGAAGG + Intronic
986615932 5:9617499-9617521 CTGTCTAAAGTACTGATGGATGG + Intergenic
999499558 5:152133034-152133056 CTGTCCTAGGGCCTTGTGGAAGG - Intergenic
1000168349 5:158677313-158677335 CTGCCCCAAGGACTCCTGGCAGG + Intergenic
1000274956 5:159725850-159725872 CTGTGCAAAAGTCTTGTGGAAGG - Intergenic
1001569488 5:172720900-172720922 CTGCCCAATGGACTCCTGGATGG - Intergenic
1003519329 6:6844135-6844157 CTGCCCAAAGGACTTGGGAAGGG + Intergenic
1006453699 6:34120263-34120285 CTGTGCTGAGGCCTCGTGGAGGG - Intronic
1006581887 6:35082127-35082149 CTGTCCAGGGCACTGGTGGAAGG - Intronic
1008766606 6:54924729-54924751 GAGTCCAAAGGTCTTGTGGATGG - Intronic
1018553502 6:165026040-165026062 TTGTCCATAGGACAAGTGGAGGG - Intergenic
1019257522 7:61660-61682 CAGTGGAAAGGACTCGGGGACGG - Intergenic
1023872577 7:44270692-44270714 CTGTCCAGAGGACACTTTGAGGG + Intronic
1023885435 7:44350495-44350517 CTGGCCAAAGGACTGGGGAAAGG + Intergenic
1033653733 7:143360433-143360455 CCGTCCTGAGGACTCTTGGAGGG + Intronic
1035074339 7:156168667-156168689 CTGTAGGAAGGCCTCGTGGATGG - Intergenic
1039185819 8:34915183-34915205 CTGTTCAAAGGACTAGTGTGAGG - Intergenic
1039789442 8:40863005-40863027 CTGTGCAAAGGACTAATGGTTGG + Intronic
1050372528 9:4936158-4936180 CTGGCCAAGAGATTCGTGGAGGG + Intergenic
1053218653 9:36293495-36293517 TTGTCCCAAGGAGTTGTGGATGG + Intronic
1056316880 9:85398697-85398719 CTGTGCAAAGACCTCATGGAGGG - Intergenic
1060554601 9:124501752-124501774 CTGGAGAAAGGACTCCTGGATGG - Intronic
1186851301 X:13582851-13582873 CTGTACCAAGGACTCGTGGCTGG + Intronic
1200141539 X:153905182-153905204 CTGCCCACCGGACTCATGGAGGG - Intronic