ID: 952245035

View in Genome Browser
Species Human (GRCh38)
Location 3:31578689-31578711
Sequence CTGCATGCATGGAAGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 5, 3: 27, 4: 312}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952245035_952245042 24 Left 952245035 3:31578689-31578711 CCTTTCTCCTTCCATGCATGCAG 0: 1
1: 0
2: 5
3: 27
4: 312
Right 952245042 3:31578736-31578758 CCAGTTATTTTTCTGGATGCTGG 0: 1
1: 0
2: 4
3: 24
4: 295
952245035_952245044 26 Left 952245035 3:31578689-31578711 CCTTTCTCCTTCCATGCATGCAG 0: 1
1: 0
2: 5
3: 27
4: 312
Right 952245044 3:31578738-31578760 AGTTATTTTTCTGGATGCTGGGG 0: 1
1: 0
2: 3
3: 45
4: 493
952245035_952245040 17 Left 952245035 3:31578689-31578711 CCTTTCTCCTTCCATGCATGCAG 0: 1
1: 0
2: 5
3: 27
4: 312
Right 952245040 3:31578729-31578751 CTTTGTGCCAGTTATTTTTCTGG 0: 1
1: 0
2: 3
3: 42
4: 415
952245035_952245043 25 Left 952245035 3:31578689-31578711 CCTTTCTCCTTCCATGCATGCAG 0: 1
1: 0
2: 5
3: 27
4: 312
Right 952245043 3:31578737-31578759 CAGTTATTTTTCTGGATGCTGGG 0: 1
1: 1
2: 2
3: 29
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952245035 Original CRISPR CTGCATGCATGGAAGGAGAA AGG (reversed) Intronic
900034733 1:397635-397657 TTGAATGCATGGAAAAAGAAAGG + Intergenic
901928582 1:12582891-12582913 ATGCATGGATGGATGGAGTAGGG - Intronic
901928784 1:12583713-12583735 ATGCATGAATGGATGGAGTAGGG - Intronic
903511153 1:23875811-23875833 CTTCCTGCTTGGATGGAGAAAGG - Intronic
903674231 1:25054351-25054373 ATGGATGGAAGGAAGGAGAAAGG - Intergenic
904449624 1:30602405-30602427 CCAGATGCATGGAAGGAGAATGG - Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
905154735 1:35966463-35966485 CTGTAAGGATGGGAGGAGAAAGG + Intronic
906699260 1:47845970-47845992 CTGCATGCTGGGAAAGTGAAAGG + Intronic
906841861 1:49147815-49147837 CTTCAAGCAGGGAAGGAGAGGGG + Intronic
906905529 1:49886697-49886719 CAGTCTGTATGGAAGGAGAATGG - Intronic
907395947 1:54189971-54189993 ATGTGTGCATGGAAAGAGAAAGG - Intronic
908437474 1:64120830-64120852 GTGGATGGATGGATGGAGAATGG + Intronic
909430097 1:75577474-75577496 CTGGATGTCTGGAAGAAGAAAGG - Intronic
912654365 1:111472376-111472398 TTGGATGGATGGAGGGAGAAAGG - Intergenic
915346747 1:155201384-155201406 CTTCAGGCGTGGAAGGAAAAGGG - Intronic
920310928 1:205047873-205047895 CTGCAAGAATGGGATGAGAAGGG - Intronic
922236919 1:223728879-223728901 CTGGCTGAATGGAAGCAGAAAGG - Intronic
922257256 1:223903193-223903215 TTGAATGCATGGAAAAAGAAAGG + Intergenic
923545506 1:234920405-234920427 CTGCATGAATGGAAGGGGCTGGG - Intergenic
923714412 1:236412608-236412630 TGGCAGGCATGGCAGGAGAAGGG - Intronic
924338451 1:243005985-243006007 TTGAATGCATGGAAAAAGAAAGG + Intergenic
1064102046 10:12472410-12472432 CTCCCTGCATAGAGGGAGAAGGG - Intronic
1064896381 10:20241954-20241976 ATGGATGGATGGATGGAGAAAGG + Intronic
1065313858 10:24442763-24442785 CTGGATGCATGGAAGAATAAAGG - Intronic
1065414530 10:25469912-25469934 CGGCTAGCATGGAAGAAGAAAGG - Intronic
1065490559 10:26277758-26277780 CTGGAGGCCTGGAAGGAAAATGG + Intronic
1067656193 10:48193462-48193484 ATTTCTGCATGGAAGGAGAAAGG - Intronic
1067784841 10:49238057-49238079 CTGCACACATGGTAGGAGAAAGG - Intergenic
1068313956 10:55317838-55317860 CTGCACGCATGGAACTGGAAAGG + Intronic
1069702428 10:70436357-70436379 CTTCATGTATGGGAGGAGACAGG - Intronic
1072316378 10:94207217-94207239 CAGCATGCAAGGATGCAGAATGG + Intronic
1072945169 10:99803469-99803491 ATGGATGGATGGAAGGAGAGAGG - Intronic
1073948125 10:108776040-108776062 CTGCAGGCATTGAATGAGAAAGG - Intergenic
1076433792 10:130425866-130425888 GTGGATGGAGGGAAGGAGAAGGG + Intergenic
1077352210 11:2098256-2098278 CAGCATGCATGCAAGGACGAGGG - Intergenic
1079984573 11:27187203-27187225 CTGCCTACTTGTAAGGAGAAAGG + Intergenic
1080237071 11:30082860-30082882 GTACAAGCATGGAAAGAGAAGGG - Intergenic
1080271780 11:30458165-30458187 CTCCATGCATAGAACTAGAAAGG - Intronic
1081706144 11:45182838-45182860 CTGGAGGGATGGAAAGAGAAGGG - Intronic
1083609175 11:63997027-63997049 CTGCAGCCACGGAGGGAGAAAGG - Intronic
1083879852 11:65543013-65543035 GTGGATGGATGGATGGAGAAAGG + Intronic
1084322524 11:68381551-68381573 CTGCATGCGTGCAGGGAGGAAGG + Intronic
1086719118 11:90098656-90098678 CTGCATGCAGGGCAGGAGTGTGG + Intergenic
1091159429 11:133406352-133406374 CTTTCTGCATGGAAGGAGAATGG - Intronic
1092958933 12:13577415-13577437 CAGCAGCCATGCAAGGAGAAAGG + Intronic
1093170628 12:15856260-15856282 TGGCATACATGGAAGGAGGATGG + Intronic
1093197885 12:16150291-16150313 ATGCAGGCAACGAAGGAGAAGGG - Intergenic
1093416319 12:18925041-18925063 CTGGATGCCTGGAAGGACAAAGG + Intergenic
1094484690 12:30915129-30915151 CTGAATGAAAGGAAGGAGTAAGG + Intergenic
1095722844 12:45419741-45419763 CTGGTTGGAAGGAAGGAGAAAGG - Intronic
1096148044 12:49292987-49293009 CTACATGCCTCGGAGGAGAAGGG - Intergenic
1096536760 12:52279827-52279849 GTGAATGGATGGATGGAGAATGG - Intronic
1097338056 12:58406787-58406809 CTGAATGCAGAGAAGGAGGAGGG + Intergenic
1097559422 12:61184599-61184621 CTGCAAACTTCGAAGGAGAAAGG + Intergenic
1097771051 12:63585600-63585622 CTGCATGCAAGGAAGAAGCCTGG + Intronic
1098232428 12:68386061-68386083 CTGCATGTAAGACAGGAGAAGGG - Intergenic
1098441209 12:70520860-70520882 TTGAATCCCTGGAAGGAGAAAGG + Exonic
1098700525 12:73618862-73618884 ATGTATGAATGGAAGGAGAAAGG - Intergenic
1100184970 12:92129071-92129093 CTGCATGGAGGGAGGGGGAAGGG + Intronic
1101727091 12:107396796-107396818 CTGCCTGGAGGGAAGGAGGAAGG - Intronic
1103941441 12:124503425-124503447 ATGCATGCATGGATAGAGAAAGG + Intronic
1105334231 13:19449922-19449944 CTGAAAGAAGGGAAGGAGAAAGG - Intronic
1105440088 13:20407880-20407902 CTGCATACATGGGAACAGAAAGG - Intronic
1106363188 13:29051170-29051192 CTGGGAGGATGGAAGGAGAAAGG + Intronic
1107109593 13:36682214-36682236 CTGCATGAATGAAAGAATAAGGG - Intronic
1107962604 13:45571807-45571829 AGACATGCATGGAGGGAGAATGG + Intronic
1108178639 13:47819612-47819634 AGGCATGCCTGGAAGGTGAAGGG - Intergenic
1108573489 13:51771839-51771861 CAGGATGCATGGAAGAAAAATGG + Exonic
1108628193 13:52253591-52253613 CTGAAAGAAGGGAAGGAGAAAGG - Intergenic
1108657866 13:52552858-52552880 CTGAAAGAAGGGAAGGAGAAAGG + Intergenic
1108959947 13:56214358-56214380 CTGCATGAATCCAGGGAGAAAGG - Intergenic
1110633584 13:77738558-77738580 CTCCATCCATGGTAGGAGGAGGG - Intronic
1112258700 13:97858234-97858256 CAGCAGGCCTGGAAGGAGGAAGG + Intergenic
1113072694 13:106436834-106436856 CAGAATGCATGGAAGGAAGATGG + Intergenic
1113190809 13:107743247-107743269 CTGCAGGAAAGGAAGGAGATAGG - Intronic
1113276346 13:108734958-108734980 CTGCACACATGGTAGGAGAAAGG + Intronic
1113365116 13:109668808-109668830 CTGGATGCCTGAAAGTAGAAAGG + Intergenic
1113743458 13:112726343-112726365 CTGCATGCGTGCAGGGAGAGGGG + Intronic
1113824792 13:113243341-113243363 CTGCATGCATGGGTGGAGGAGGG + Intronic
1114380820 14:22201631-22201653 TGGCATACATTGAAGGAGAAAGG - Intergenic
1114752187 14:25217433-25217455 GTGCACACATGGAGGGAGAAAGG + Intergenic
1116394418 14:44430545-44430567 CTGAATGCTTGGAAGCAGGAGGG - Intergenic
1116965306 14:51008596-51008618 ATGCAAGCCTGGAAGGAAAATGG - Intronic
1118002907 14:61540210-61540232 CTGATTCTATGGAAGGAGAAGGG - Intronic
1119194413 14:72706404-72706426 CAATATGCTTGGAAGGAGAAAGG - Intronic
1120729680 14:87989039-87989061 CAGAATGCATGGAAAGACAAGGG + Intronic
1120786086 14:88538263-88538285 CTTCATCCAAGCAAGGAGAAAGG - Intronic
1121182574 14:91940613-91940635 GTGCCTGCAGGGAAGGAGAGAGG + Exonic
1121739969 14:96244806-96244828 ATGGATGCATGGATGGAGGAGGG - Intronic
1122638226 14:103140336-103140358 GTACATTCCTGGAAGGAGAATGG - Intergenic
1122639028 14:103146437-103146459 CTGGAGGCATGGATGGGGAAGGG + Intergenic
1122674483 14:103399877-103399899 TTGCATTCAAGGAAGGAGGAAGG + Intronic
1123947403 15:25245442-25245464 CTGGATGCATGCATGGAGAGGGG + Intergenic
1124434783 15:29638110-29638132 CTGCAAGGAAGGAAGGGGAAAGG + Intergenic
1127524336 15:59777297-59777319 CTGCCTAAGTGGAAGGAGAATGG - Intergenic
1127675262 15:61232132-61232154 CTGCATGGATGGCTGCAGAAAGG - Intergenic
1128213281 15:65916911-65916933 CTGCATGCGTGGAAGCAGGCGGG + Exonic
1128585771 15:68848992-68849014 GTGGATGCATGGGAGGAGAGGGG + Intronic
1128722000 15:69956952-69956974 CTCCATGTATTGTAGGAGAAAGG - Intergenic
1129273061 15:74429437-74429459 CTGCAGAGATGGAAGGAGCATGG - Intronic
1129569591 15:76666483-76666505 ATGCATGTATGAAAGAAGAAAGG - Intronic
1129633932 15:77294021-77294043 CTGCATTCATGGAAGGAAAAAGG + Intronic
1129830441 15:78666203-78666225 CTTCAATCATGGCAGGAGAAGGG - Intronic
1131070598 15:89463311-89463333 CTGCCTGCCTGGAAGGGGGAAGG + Intergenic
1131408716 15:92188013-92188035 CTGCCTGAGTGAAAGGAGAATGG - Intergenic
1132997682 16:2831703-2831725 CTGCATCCCGGGAAGGAGGATGG + Intronic
1133046223 16:3089767-3089789 CCGCAAGCCTGGCAGGAGAAGGG + Exonic
1134605096 16:15564073-15564095 CTACATTCATAGAAGGTGAAAGG - Intronic
1135140923 16:19921442-19921464 TTACAATCATGGAAGGAGAAAGG + Intergenic
1136026305 16:27471150-27471172 CTGAGTGCGGGGAAGGAGAATGG + Intronic
1137386134 16:48044143-48044165 CTGGATGGATGGATGGTGAATGG - Intergenic
1138748133 16:59387292-59387314 GTGCATGCAAGGATGGAGGATGG + Intergenic
1139082314 16:63538062-63538084 ATGCATATTTGGAAGGAGAAAGG + Intergenic
1139293563 16:65879364-65879386 CTGAATGCATGGATGGAGGGTGG + Intergenic
1139982737 16:70872795-70872817 CTGCATGGATGGATGGATGATGG - Intronic
1140155421 16:72420264-72420286 CTACAGGCTTGGCAGGAGAATGG - Intergenic
1140855145 16:78971516-78971538 CTACAGCCATGGAAAGAGAATGG + Intronic
1140989247 16:80192318-80192340 ATAGATGCATAGAAGGAGAAGGG - Intergenic
1141606498 16:85156941-85156963 ATGGATGGATGGATGGAGAAAGG - Intergenic
1141977121 16:87524371-87524393 CTGCCTAGATGGAAGGAGAGTGG + Intergenic
1142899524 17:3003615-3003637 CTGCATGGCTGGAAGGAGGAAGG - Intronic
1143858160 17:9868126-9868148 ATGAATGAATGAAAGGAGAAAGG + Intronic
1143881529 17:10033786-10033808 CTGCAGGCACTGAAGGAAAATGG + Intronic
1144130669 17:12243571-12243593 CTGCTTGCATGGAAGGAGGAAGG - Intergenic
1145107164 17:20127856-20127878 GTGCATGCAGGCAAGGAGAAGGG + Intronic
1145897884 17:28471133-28471155 CTGCATTAATTAAAGGAGAAGGG + Intronic
1146980902 17:37160611-37160633 GTGCAGGCATGGGAGCAGAATGG + Intronic
1147152867 17:38528379-38528401 CTGCACGCCTGGAAGGAGGCAGG - Intergenic
1147304278 17:39552517-39552539 GAGCATGCATTGAAGGAGAGAGG + Intronic
1147531605 17:41283746-41283768 CAGCACACATGGGAGGAGAAGGG + Intergenic
1147761054 17:42797734-42797756 CTGCGTCCCTGGAAGGTGAAGGG + Exonic
1149578178 17:57728615-57728637 CAGCACCCATGGAAGGGGAAAGG - Intergenic
1150501701 17:65657400-65657422 CTACAGGCATGGGATGAGAAAGG + Intronic
1152157620 17:78645215-78645237 CTGCATTCAGGGCAGGAGAAGGG - Intergenic
1153783953 18:8517724-8517746 CTTCATTCATGGAAGGAAAGTGG + Intergenic
1154931922 18:21007591-21007613 CTGCATCAATGGGAGTAGAAAGG + Intronic
1156493258 18:37508874-37508896 CTGTATGCTTGGAGAGAGAAGGG + Intronic
1156495325 18:37521794-37521816 CTGCCTGCATGGCAGGATGAAGG - Intronic
1157171607 18:45412003-45412025 GTGCCAGGATGGAAGGAGAAAGG - Intronic
1160131198 18:76226315-76226337 CTGCACACACAGAAGGAGAAAGG + Intergenic
1160131317 18:76227285-76227307 CTGCACACACAGAAGGAGAAAGG + Intergenic
1161844673 19:6706065-6706087 ATGCATGCATGAATGAAGAAGGG + Intronic
1162156238 19:8679707-8679729 AGGCATGGAGGGAAGGAGAAGGG - Intergenic
1162265166 19:9567210-9567232 CTGTATGCATGTAATGAAAATGG - Intronic
1164801777 19:31083119-31083141 CTGCATGCATGTAACGGGAATGG - Intergenic
1164866380 19:31607537-31607559 TTGCATGCTTGTAAGCAGAAGGG - Intergenic
1165027016 19:32969572-32969594 CTGCAGGGATGGAGGGTGAAGGG + Intronic
1165986287 19:39771641-39771663 CAGCATGCATGGAGGAAGACGGG + Intergenic
1166053433 19:40274710-40274732 CTGCAGGCAGGGGAGGAGCAGGG + Intronic
1166136246 19:40778710-40778732 CTGCATGAATGGCAGGAGTCGGG + Intronic
1167233785 19:48301773-48301795 CTGCATGGATGGATGGACATGGG + Intronic
925077527 2:1030003-1030025 CAGCATGCAGGGAAAGGGAATGG - Intronic
927203874 2:20594839-20594861 CTTCATGGATGGAAGGGGCAAGG + Intronic
927939115 2:27092712-27092734 CAGGAAGCAAGGAAGGAGAAAGG - Intronic
927941047 2:27102934-27102956 CTCCCAGCATGGAAGGAGAGGGG - Intronic
929705001 2:44201280-44201302 CAGCATGCAAGGATGGAGAGTGG + Exonic
930005895 2:46896308-46896330 CTGCATCCATGGCAGCAGAGTGG - Intergenic
932056958 2:68455487-68455509 CTGCATGGATGTCAGGAAAAAGG - Intergenic
933703644 2:85273895-85273917 CTGCAGGCTGTGAAGGAGAAAGG + Intronic
934904097 2:98184277-98184299 CTGCAAGGATGGAAGGAGAAAGG - Intronic
938108034 2:128546613-128546635 ATGGATGCATGGATGGATAATGG - Intergenic
938108073 2:128546804-128546826 ATGGATGGATGGATGGAGAATGG - Intergenic
938108109 2:128546969-128546991 ATGGATGCATGGATGGATAATGG - Intergenic
940580920 2:155578945-155578967 CTAGAGGCAGGGAAGGAGAAGGG + Intergenic
941329060 2:164154797-164154819 CTGTATGAATTTAAGGAGAAAGG + Intergenic
943382773 2:187171830-187171852 CTGGGTTCATAGAAGGAGAAAGG + Intergenic
944527575 2:200635684-200635706 CAGCATGCATGGAAGGAAGGAGG + Intronic
946566230 2:220968819-220968841 ATGCATTCATGAAAAGAGAAAGG - Intergenic
947229327 2:227869585-227869607 CTGCATGTATGCAGGGAGACTGG - Intergenic
948246416 2:236489585-236489607 ATGCATGGATGGAAGCAGAAGGG + Intronic
948473941 2:238204233-238204255 CTCCATGCCTGTAAAGAGAAAGG + Intergenic
948797418 2:240412080-240412102 CTGTGTGCGGGGAAGGAGAACGG - Intergenic
1168756639 20:323102-323124 ATGCATGCATGGATGGAAGAAGG + Intergenic
1169055235 20:2615372-2615394 CAGCATGCATGGATGGAAGAAGG - Intronic
1169395283 20:5223724-5223746 ATGCATGCATGGAAGAGAAAGGG - Intergenic
1170734348 20:19001259-19001281 CTGCACCCATGGAGGAAGAAAGG + Intergenic
1171030070 20:21669135-21669157 CTGCAAGCTTGGAAGGAGATGGG + Intergenic
1171096010 20:22332805-22332827 CTGGAGGCATGGGATGAGAAGGG - Intergenic
1171119170 20:22553327-22553349 ATGCATGGATGGAAGGAGGCTGG + Intergenic
1172440682 20:34964342-34964364 ATGAATGCATGAAAGCAGAAGGG + Intergenic
1173784399 20:45782245-45782267 CTGCAGGCATTGAGGGAGACGGG - Intronic
1174036820 20:47673639-47673661 CTGCATGCATTGAAGGGGATGGG - Intronic
1175173175 20:57093791-57093813 CAGCACCCATGGAGGGAGAAGGG - Intergenic
1175367834 20:58467659-58467681 CTGCAGGGGTGGAAGGAGATGGG + Intronic
1175688001 20:61045319-61045341 ATGCATGGATGGATGGTGAAAGG - Intergenic
1176286558 21:5022003-5022025 ATGCATGAATGGAAGGAGGGAGG - Intergenic
1176738827 21:10578737-10578759 CTGAAAGAAGGGAAGGAGAAAGG + Intronic
1177139346 21:17341762-17341784 TACCTTGCATGGAAGGAGAAAGG - Intergenic
1177943371 21:27438240-27438262 ATGGATGGATGAAAGGAGAAAGG + Intergenic
1178529777 21:33366140-33366162 CTGCAGGCATTGAAGGAAGAGGG - Intergenic
1179870623 21:44241472-44241494 ATGCATGAATGGAAGGAGGGAGG + Intergenic
1180255085 21:46621432-46621454 CTGAATGGATGAAGGGAGAAGGG - Intergenic
1181520386 22:23445770-23445792 CCTCATTCATGGAAGGAGTAGGG + Intergenic
1181804101 22:25364828-25364850 CTGCATGCGTGCAAGGAGGAAGG - Intronic
1181857594 22:25793081-25793103 GTGAAGGCATGGAAGGAGAGAGG + Intronic
1183302797 22:37066508-37066530 GTGGATGCATGGAAGAAGAAAGG - Intronic
1184885774 22:47343716-47343738 CTGCATGCAGGGACTGAGTAGGG - Intergenic
949291171 3:2467855-2467877 CTGCATGAATGGCAAAAGAAAGG - Intronic
949331701 3:2930742-2930764 CTGCATCCATGGAATGAAACTGG - Intronic
949761764 3:7478807-7478829 CTGCATGCCTGGGGGGAGATGGG - Intronic
950111461 3:10421354-10421376 CAGCTTTCAGGGAAGGAGAAGGG - Intronic
950931898 3:16798067-16798089 CCTCAGGCATGGAAGCAGAAAGG + Intergenic
950954015 3:17031415-17031437 CTGCAGACATGAAAGGAGGAAGG - Intronic
951661099 3:25067690-25067712 GTGCAAGCATAGGAGGAGAAGGG - Intergenic
952005206 3:28835713-28835735 CATCATGCAAGGAAGGAGCAGGG + Intergenic
952245035 3:31578689-31578711 CTGCATGCATGGAAGGAGAAAGG - Intronic
955167875 3:56532677-56532699 CTGGATGCATGACTGGAGAAAGG + Intergenic
955395884 3:58556902-58556924 CTGCCGGCAGGGAAGGAGGAAGG + Intergenic
955510015 3:59670256-59670278 CTCAATGTATGGAAGAAGAAAGG - Intergenic
957510741 3:81184658-81184680 CTGCAGACATGGAAGAAGATTGG + Intergenic
961413951 3:126743986-126744008 CAGCAAGCATGGCAGCAGAAGGG - Intronic
961514558 3:127424633-127424655 GTGCATGCATGCAGGGAGAGGGG - Intergenic
961567774 3:127775929-127775951 CTGCCTGCATGGAAGGCCAAGGG + Intronic
962425740 3:135267857-135267879 CTGCAAACATGCAAGGCGAAGGG - Intergenic
962869046 3:139472390-139472412 CTGCCTGCATTCAAGGAAAAGGG - Intronic
964406869 3:156358354-156358376 CAGCAAGAAGGGAAGGAGAAGGG + Intronic
966548260 3:181175670-181175692 ATGCATGCCTTGAAGGAAAATGG + Intergenic
967653213 3:192012515-192012537 CTGCATACTTGGAAGAAGACAGG + Intergenic
967847248 3:194054031-194054053 CTGCATCCATGGATGGACAGAGG - Intergenic
967943320 3:194783075-194783097 CAGCAAGCACGGAAGGAGGAAGG - Intergenic
969077581 4:4592474-4592496 CTGCATGCCTGGGAGGATATGGG + Intergenic
969218547 4:5743673-5743695 CTGCATCCCAGGAAGGAGGAAGG + Intronic
969485194 4:7468235-7468257 CTCCATACCTGGAAGGAGGACGG - Intronic
969855473 4:9995715-9995737 CCAAATGAATGGAAGGAGAATGG - Intronic
970126803 4:12822800-12822822 CTTCATGGATGGAAGCTGAAGGG + Intergenic
970970276 4:21975349-21975371 CTGAATGGATGGAAGCAGTAAGG + Intergenic
973822651 4:54676583-54676605 CTGCATGGGTGGAGGGAGCAGGG + Intronic
974892661 4:67900354-67900376 CTGCCTACTTGGAAGCAGAAGGG + Intergenic
975708905 4:77139317-77139339 GGGCATGGATTGAAGGAGAAGGG + Intergenic
976173332 4:82326888-82326910 CAGTATCCATGGAAGGAGGAGGG - Intergenic
977959377 4:103068461-103068483 CTACATTCTAGGAAGGAGAAAGG - Intronic
978706098 4:111713572-111713594 CTGCATTCAGGGATGGAAAAGGG + Intergenic
979238669 4:118429267-118429289 TTGAATGCATGGAAAAAGAAAGG - Intergenic
979389584 4:120112326-120112348 GTGCATGTGTGGAAGGTGAAGGG + Intergenic
979498606 4:121412603-121412625 GTGTATGCATGGATGGAGAGTGG - Intergenic
979926285 4:126569044-126569066 CTGCCAGCATTGAAGGAGAGAGG + Intergenic
981085727 4:140681430-140681452 CTGAGTGGATGGCAGGAGAAAGG + Intronic
981403108 4:144337553-144337575 CTGCATGCAGGGGATTAGAAGGG - Intergenic
981775405 4:148361712-148361734 TTGTAAGAATGGAAGGAGAAGGG - Intronic
983098352 4:163593348-163593370 CTGCATACATTGAAGTAAAAAGG + Intronic
984371100 4:178864997-178865019 ATGCATGCATGGCAGAGGAAAGG + Intergenic
985200119 4:187476064-187476086 CTGGATGCCAGGCAGGAGAAAGG + Intergenic
985358533 4:189146747-189146769 CTGAAAGCAGGCAAGGAGAAAGG + Intergenic
988627082 5:32888782-32888804 CTGTGTGTCTGGAAGGAGAAAGG + Intergenic
989244359 5:39237315-39237337 GTGCATACATGGAAGTAAAAGGG + Intronic
991689359 5:69211617-69211639 CTGCATGAAAGGATGCAGAAAGG - Intergenic
992144764 5:73835081-73835103 CAGCATCCACGGAAGGAGGAGGG + Intronic
992223894 5:74599749-74599771 CTTCAAGGATGGGAGGAGAAAGG - Intergenic
992488023 5:77214378-77214400 CTGTATGAATGGAGGGAAAACGG - Intronic
993746920 5:91611781-91611803 CTACATGCATGGAATGTGCAGGG - Intergenic
995435482 5:112130105-112130127 CTCCATGCATGGGTGGAAAATGG - Intergenic
998985956 5:147757074-147757096 ATGCATGCATGGAGGCATAAAGG + Intronic
999331308 5:150675200-150675222 CTGCATGCCTGTAGGGGGAATGG + Intronic
999445012 5:151632319-151632341 ATGGATGCATGGATGGATAATGG + Intergenic
1001125918 5:169019104-169019126 CTGCATCCTGGGAAGGAGAAAGG + Intronic
1001257345 5:170194057-170194079 CTGGAGGCATGTAAGCAGAATGG + Intergenic
1001432291 5:171672347-171672369 ATGCATACATGGTAGTAGAAAGG + Intergenic
1001833904 5:174813932-174813954 CTGTATCCATGGAATAAGAAGGG - Intergenic
1001928477 5:175656758-175656780 CTGGAAGCAGGGAAGTAGAAAGG + Intergenic
1002739086 5:181421236-181421258 TTGAATGCATGGAAAAAGAAAGG - Intergenic
1002761288 6:204423-204445 TTGAATGCAAGGAAGGAGCAGGG - Intergenic
1003350731 6:5315350-5315372 CTGCATGCAAGGAAGGAGATGGG - Intronic
1003764986 6:9225678-9225700 CTGCATTCATGGAAAGAATAGGG - Intergenic
1004374153 6:15077208-15077230 CTGCATGCCTGGAAGGAGAGGGG - Intergenic
1004894871 6:20138908-20138930 CCGGAAGCAAGGAAGGAGAATGG - Intronic
1005639180 6:27778524-27778546 CTGTAAGTATGGAAGGAGGAGGG - Intergenic
1006001621 6:30969579-30969601 CACTTTGCATGGAAGGAGAACGG + Intergenic
1008041718 6:46808644-46808666 GTGCATGCATGCTAGGTGAAAGG + Intronic
1008888768 6:56460628-56460650 CTGCATGCATAGAGGGGGCATGG + Intronic
1011751287 6:90457652-90457674 CTCCATTCATGGCAGGAGGAAGG + Intergenic
1012372384 6:98523399-98523421 CTGCAGGCATGGAAGTAAAATGG + Intergenic
1013403022 6:109817070-109817092 CTGCATCCAGGCAGGGAGAAAGG + Intronic
1013614933 6:111834197-111834219 CTGGTTCCATTGAAGGAGAAGGG + Intronic
1014432595 6:121388511-121388533 CTGCAGGGATGGAAGGAGAGGGG - Intergenic
1019244196 6:170696788-170696810 TTGAATGCATGGAAAAAGAAAGG - Intergenic
1019740336 7:2669908-2669930 ATGCATGCAGGGGAGGAGAGAGG + Intergenic
1021149803 7:17135531-17135553 CAGCCTGCATGGAAGGAGTGGGG + Intergenic
1021400021 7:20199035-20199057 CTGCCAGTATGTAAGGAGAATGG + Intronic
1021419986 7:20435590-20435612 CTGCATGCTTGGAATATGAATGG + Intergenic
1022930537 7:35107866-35107888 CTGCATGCAAGGAAGAAGCCTGG + Intergenic
1023423211 7:40006239-40006261 CTTCATGTATGGAAGGAGAGTGG + Intronic
1023607753 7:41945495-41945517 CTGCAAGCTCGGAAGGAAAATGG - Intergenic
1024660142 7:51485563-51485585 CTGCAAGCGTGGCAGGAGAAGGG - Intergenic
1026282339 7:68933098-68933120 CTGCATGCCTGGAGTGAGCAGGG - Intergenic
1027688137 7:81303934-81303956 CAGCCTGCATGGAAGGAGGTTGG - Intergenic
1029747273 7:102523132-102523154 CTGCATCCATGAAAGGGGGATGG - Intergenic
1029765226 7:102622222-102622244 CTGCATCCATGAAAGGGGGATGG - Intronic
1031804172 7:126288660-126288682 CTGCATTCATGCAAGAAGACTGG + Intergenic
1033026718 7:137781582-137781604 CTGCAGTCATGGAAGGAGAGTGG - Intronic
1035279101 7:157766093-157766115 ATGGATGAATGGAAGAAGAATGG - Intronic
1035288681 7:157823073-157823095 ATGCATGCATGGATGGATGATGG - Intronic
1035503927 8:111372-111394 TTGAATGCATGGAAAAAGAAAGG + Intergenic
1035576426 8:709824-709846 CTGTATGCATGGATGGATGATGG - Intronic
1036649356 8:10632510-10632532 CTGCAGGCATGCAGGGGGAAAGG - Intronic
1037444949 8:18956090-18956112 CTGAATGAATGGAAGGAAGAAGG + Intronic
1039955148 8:42201693-42201715 CTGCATGCATGGTGTGGGAAAGG - Intronic
1040584521 8:48726826-48726848 GTGGATGCATGGATGGACAATGG - Intronic
1041531495 8:58873181-58873203 CTGCATGCATACAAACAGAATGG + Intronic
1045866210 8:106868493-106868515 CTGCATGTGTGCAGGGAGAAGGG - Intergenic
1046362976 8:113186125-113186147 TTCCATGCATGGAAGGTGACTGG - Intronic
1046621570 8:116533990-116534012 CTGCTTGTGTGGAAGGAGGAGGG + Intergenic
1049359990 8:142207796-142207818 ATGCATGGATGGATGGGGAATGG + Intergenic
1049371991 8:142272369-142272391 GTGGATGGATGGAAGGAGGAAGG - Intronic
1049372052 8:142272613-142272635 GTGGATGGATGGAAGGAGGAAGG - Intronic
1049474881 8:142792463-142792485 ATGGATGGATGGAAGGTGAACGG - Intergenic
1050292204 9:4166593-4166615 CTGAACTCCTGGAAGGAGAAGGG - Intronic
1050499370 9:6279061-6279083 TTGCATGGATGGAAGGTGACCGG - Intergenic
1051679360 9:19591600-19591622 CTGTATTCTTGGAAGGAGGAAGG - Intronic
1052235248 9:26205378-26205400 CTGCAGCCAGGGAAAGAGAAAGG + Intergenic
1053307872 9:36996629-36996651 ATGCATCCAGGGAAGGAAAAGGG + Intronic
1056108087 9:83367389-83367411 CTGCATTCAGGGAAAGAGATGGG - Intronic
1056684006 9:88744720-88744742 ATACATCCATGGAGGGAGAAGGG + Intergenic
1056722125 9:89081623-89081645 CTGAATGCATTGAATTAGAAAGG - Intronic
1057008701 9:91583223-91583245 CTGGATGGATGGATGGAGGATGG + Intronic
1058726272 9:107807644-107807666 CTCAATGGATGGAAGGAGACTGG + Intergenic
1060377576 9:123130895-123130917 CTGGAGGCAGGGAAGAAGAAAGG - Intronic
1060818177 9:126646433-126646455 CTGCATGGATGGAAAGACAGAGG - Intronic
1060925470 9:127452346-127452368 CTGCCTGCAAGGATGGGGAATGG - Intronic
1061014534 9:127974229-127974251 CTGCACCCAGGGAAGGACAATGG - Intronic
1062103550 9:134740584-134740606 CTGGATGGATAGAAGGAGGACGG - Intronic
1062600512 9:137316847-137316869 CTGCCTGGATGGAAGGGGAGTGG + Intronic
1203604385 Un_KI270748v1:46012-46034 TTGAATGCATGGAAAAAGAAAGG - Intergenic
1186171231 X:6879191-6879213 CTACATGCAGTGAAGGAAAAAGG + Intergenic
1187233880 X:17448449-17448471 GGGCATTCATGAAAGGAGAAAGG - Intronic
1187358536 X:18602053-18602075 ATGCCTGCAGGGAAGGAGCAGGG + Intronic
1187444219 X:19346198-19346220 CTCCATGAAGGGAGGGAGAAGGG + Intronic
1187495846 X:19794845-19794867 CTGAATGAATGGAAGGAGTAAGG - Intronic
1188614957 X:32146421-32146443 ATGGATGGATGGAAGGAGACAGG + Intronic
1189109734 X:38276337-38276359 CCGCATGAGTGGAAGTAGAATGG - Intronic
1189273371 X:39767411-39767433 CTGCATGCCTGAAAGAAGGAGGG - Intergenic
1190660544 X:52650297-52650319 TTGCATCCATGGAGGGACAAAGG + Intronic
1190693911 X:52935379-52935401 CTGGCTGGATGGGAGGAGAATGG - Intronic
1192366677 X:70479609-70479631 ATGCATACATGGAAGGGGATGGG - Intronic
1193631015 X:83888664-83888686 TGGCATCCATGAAAGGAGAAAGG + Intergenic
1193954280 X:87839536-87839558 TTGCATGCATTGCAGGAGATTGG - Intergenic
1194218835 X:91167090-91167112 CACCATGAAGGGAAGGAGAATGG - Intergenic
1195029989 X:100917485-100917507 GTGCATGCCTGTAAGGAGGAAGG + Intronic
1195323307 X:103738516-103738538 CTGCATTCATTGAATGGGAATGG - Intergenic
1195416442 X:104625173-104625195 ATGCATGGATGGATGGAGGATGG - Intronic
1196650126 X:118159915-118159937 ATGGATGGATGGATGGAGAATGG + Intergenic
1200301906 X:154984866-154984888 CTGGGAGCAGGGAAGGAGAAAGG - Intronic
1200555344 Y:4630844-4630866 CACCATGAAGGGAAGGAGAATGG - Intergenic
1201303152 Y:12527577-12527599 ATGCAGGAAGGGAAGGAGAAAGG + Intergenic
1202597565 Y:26558267-26558289 CTGAAAGAAGGGAAGGAGAAAGG + Intergenic