ID: 952245069

View in Genome Browser
Species Human (GRCh38)
Location 3:31579098-31579120
Sequence ATGTTCCTCTTTTAGAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 230}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952245066_952245069 11 Left 952245066 3:31579064-31579086 CCTGTTCACTGTTCTTGAATCCT 0: 1
1: 0
2: 8
3: 158
4: 379
Right 952245069 3:31579098-31579120 ATGTTCCTCTTTTAGAGTGAGGG 0: 1
1: 0
2: 0
3: 13
4: 230
952245067_952245069 -9 Left 952245067 3:31579084-31579106 CCTTTTAATATTTGATGTTCCTC 0: 1
1: 0
2: 2
3: 20
4: 355
Right 952245069 3:31579098-31579120 ATGTTCCTCTTTTAGAGTGAGGG 0: 1
1: 0
2: 0
3: 13
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952245069 Original CRISPR ATGTTCCTCTTTTAGAGTGA GGG Intronic
903749846 1:25614928-25614950 TTGTTCCTCATTGAGAGTGTAGG - Intergenic
904295433 1:29517137-29517159 ATGTTCATCTTCAACAGTGAGGG - Intergenic
906071195 1:43017829-43017851 ATTTTTCTCTTTTACAGAGAAGG + Intergenic
906514341 1:46430011-46430033 ATGTTACACATTTACAGTGAAGG + Intergenic
908665839 1:66489541-66489563 ATTGTCCTATTTTACAGTGAAGG - Intergenic
910861403 1:91745629-91745651 ATTTTCCTCTTTTAAAATGCAGG - Intronic
911797977 1:102098034-102098056 ATTTTCCTCCTTTTGAGAGAAGG - Intergenic
911889297 1:103346478-103346500 ATTTTTCTCTTTTTGTGTGAAGG - Intergenic
911972520 1:104455281-104455303 ATGTAGCTCTGTTAGACTGAAGG + Intergenic
916366170 1:164030347-164030369 ATTTTACTCTTTTAGATTGAGGG + Intergenic
921456042 1:215373614-215373636 ATGTTCCTAGTTTCTAGTGATGG + Intergenic
923284152 1:232475344-232475366 CTTTTCCTCTTTTAGGGAGATGG + Intronic
924414697 1:243848139-243848161 AGGTTCCAGTTTTAAAGTGAGGG - Intronic
924642413 1:245846886-245846908 TTGTTCCTCTTTCATACTGAAGG + Intronic
1064308551 10:14190376-14190398 TTGTTCATTTTTTAGAGTCAGGG + Intronic
1064948190 10:20816472-20816494 ATGTTCCTTTTTGAGAATAATGG + Intronic
1064993706 10:21278435-21278457 CTTTTCATTTTTTAGAGTGAGGG - Intergenic
1065014178 10:21446549-21446571 ATGTTCCGGTTTTAAAGTGTTGG - Intergenic
1065021055 10:21501679-21501701 TTATCCCTCTTTTAGAGTGTGGG - Intergenic
1065807216 10:29405324-29405346 ATGTCCTTCTGTAAGAGTGAAGG + Intergenic
1067747782 10:48949410-48949432 AGGCTCCTCTTTGAGAGTGCTGG + Intronic
1068851281 10:61744371-61744393 TTGTTCATATTTTATAGTGAGGG + Intronic
1068966083 10:62913191-62913213 ATATTACTCTTTTGGGGTGATGG - Intronic
1068982534 10:63076595-63076617 ATGTTCCTCTTGAAGACAGAAGG + Intergenic
1069323588 10:67204022-67204044 ATTTTCTTCTTTTAAAGAGAGGG - Intronic
1069330370 10:67284717-67284739 AAGTTACTCTTTTGGAATGAGGG - Intronic
1070930884 10:80259850-80259872 ATGCTCCTCTTTTTGGGAGAGGG - Intergenic
1071479513 10:86054447-86054469 TTGATCTTCTTTTAGAGTTAGGG - Intronic
1072779838 10:98241162-98241184 ATTCCCTTCTTTTAGAGTGACGG - Intronic
1072853448 10:98921844-98921866 TTGTTTCTCTTTTAAAGTAAGGG + Intronic
1073269346 10:102248978-102249000 TTGTTACTGTTTTAGAGTGCAGG + Intronic
1074008454 10:109452709-109452731 ATGTTCATCTTCTAGGGTAATGG - Intergenic
1074901769 10:117822864-117822886 ATTTTCCTCAGTTAGAGTGAGGG - Intergenic
1076356243 10:129855752-129855774 ATGTTCCTTTTTTAAAGAAAAGG - Intronic
1080080441 11:28211798-28211820 ATTTTTCTCTTTTAAAATGATGG - Intronic
1080977332 11:37358340-37358362 TTGATCCTCTTTTAGTCTGATGG - Intergenic
1081306946 11:41524050-41524072 ATTTTCCTATTTTACAGTTAAGG + Intergenic
1084227116 11:67723756-67723778 ATGTTTCTCTTAAAGAGAGAAGG - Intergenic
1085160856 11:74343029-74343051 GTTTTCCTCTTTTCTAGTGATGG - Intronic
1086048687 11:82563576-82563598 ATGCTAATTTTTTAGAGTGATGG + Intergenic
1087357287 11:97110680-97110702 TTCTTCCTGTTTTAGAATGAAGG - Intergenic
1087745746 11:101944381-101944403 ATGTTCCTCTTTCACAGCGGAGG + Exonic
1089169294 11:116500893-116500915 ATGTGTCTCTTTTACAGGGAGGG - Intergenic
1091305949 11:134536170-134536192 CTCTTCCTCTTTTTGAGAGATGG - Intergenic
1092524978 12:9304359-9304381 GTCATCATCTTTTAGAGTGAAGG + Intergenic
1092542290 12:9427459-9427481 GTCATCTTCTTTTAGAGTGAAGG - Intergenic
1093771917 12:23028141-23028163 AAATTGCTCTTTTAGAGTGAAGG - Intergenic
1094211276 12:27895367-27895389 AAGTTCCTCTTCTAGAGACAAGG - Intergenic
1094510724 12:31094974-31094996 GTCATCTTCTTTTAGAGTGAAGG + Intronic
1095252105 12:39990977-39990999 ATTTTCCTCCTGTAAAGTGAAGG + Intronic
1096045840 12:48561411-48561433 ATATTTCTCTTGTAGTGTGATGG - Intergenic
1096559677 12:52426604-52426626 TCTTTCCTCTTTGAGAGTGAGGG - Intronic
1097493293 12:60296794-60296816 ATGTTCCTCTGTGTGATTGAAGG + Intergenic
1099632943 12:85174032-85174054 ATTTGCTTCTTTTAGAGTGGGGG - Intronic
1099827606 12:87798271-87798293 CTGTTGCTATTTTAGAGAGAAGG + Intergenic
1100178623 12:92059450-92059472 ATGTTCCCATTTCAAAGTGAGGG + Intronic
1100200567 12:92293610-92293632 TTGTTTCTTTTTTAGAGAGATGG - Intergenic
1101167094 12:102049668-102049690 CTGTTTCTCTTTTAGAGAAATGG - Intronic
1102920993 12:116791478-116791500 ATGTTTGTATTTTAGAGAGATGG + Intronic
1103949732 12:124544196-124544218 ATGTTCCTCTTTTACAGACAGGG - Intronic
1104237081 12:126949589-126949611 TTGGTGCTATTTTAGAGTGAAGG + Intergenic
1104735646 12:131134442-131134464 ATGTGCTACTTTTAAAGTGATGG - Intronic
1104794930 12:131510822-131510844 ATGTGCTACTTTTAAAGTGATGG + Intergenic
1107730881 13:43347346-43347368 ATATTCCTCTTTTAGGCTAATGG - Intronic
1109154154 13:58883830-58883852 AAGCTTCTCTTTTAGAATGATGG + Intergenic
1110065524 13:71100912-71100934 AACTTCCTCTTTAAGAGAGATGG - Intergenic
1110237961 13:73235993-73236015 ATGTTCTCCATTCAGAGTGAAGG - Intergenic
1110463119 13:75769187-75769209 GTGTTCCTTTTTTAGAGTTTAGG + Intronic
1111891318 13:94085935-94085957 AAGTTACTCTTTGAGAGTTAAGG - Intronic
1112688542 13:101861994-101862016 AAAGTCCTCTTCTAGAGTGATGG - Intronic
1114574852 14:23702912-23702934 ATTTTTTTCTTTTACAGTGAAGG - Intergenic
1115183833 14:30661472-30661494 ATGTATCTGTTGTAGAGTGATGG + Intronic
1115250215 14:31337304-31337326 ATGTTACTGATTTAGAGTGGTGG - Intronic
1116687939 14:48066365-48066387 CTGTTCCATTTTTAGAGTGCAGG + Intergenic
1116877397 14:50126093-50126115 CTGTTCATATTTTAGAATGAGGG - Intronic
1118191944 14:63588840-63588862 ATGTTACTCCTTTAGAGCAATGG + Intergenic
1118933123 14:70261514-70261536 CTTTTCCTTTTTTAAAGTGAGGG - Intergenic
1119939132 14:78622073-78622095 ATGTTCATAATTTAAAGTGAAGG + Intronic
1121068806 14:90997385-90997407 TTGTTTATCTTTTAGAGAGACGG + Intronic
1123914514 15:25008916-25008938 ATGTTTCTTTTTTAAAGAGATGG + Intergenic
1124364165 15:29060511-29060533 GTGTTCCTCCTGGAGAGTGATGG + Intronic
1126555201 15:49979707-49979729 ACTTTCCTCTTTTGGAATGAAGG - Exonic
1128833158 15:70787637-70787659 ATGTTGTTCTTTAAGAGTAAGGG + Intergenic
1129616753 15:77104931-77104953 ATGCTCCTCTTCCAGGGTGAAGG - Exonic
1131064869 15:89427872-89427894 TTGTTTTTCTTTTAGAGTTAGGG - Intergenic
1132056322 15:98652081-98652103 AGTTTCCTCTTTGAGTGTGATGG + Intronic
1132172368 15:99673511-99673533 ATGTTAGTCTTTTAAAATGAGGG + Intronic
1133843928 16:9436870-9436892 ATTTTTCTCTCTTTGAGTGACGG - Intergenic
1134272760 16:12747921-12747943 GTGTTCCTCTTTTAGGTTTATGG - Intronic
1138744411 16:59346981-59347003 ATGTTCCAGTTTTAGAGACAGGG + Intergenic
1138803179 16:60059926-60059948 ATTTTTCTCTTTTATAGTGTAGG - Intergenic
1140578983 16:76206255-76206277 ATCTTCCTCATTTATAGTGTTGG - Intergenic
1140599041 16:76452691-76452713 ATCCTCCTCTTTCTGAGTGATGG + Exonic
1140918358 16:79513995-79514017 ATGTTCCTCTTTTGTGGTGAGGG - Intergenic
1142728125 17:1831133-1831155 AAGTTTGTCTTTTAGAGTAAAGG - Intronic
1144589328 17:16510877-16510899 ATGTTCCCCTTTTGTAGTGATGG + Intergenic
1145173401 17:20679166-20679188 TTGTTCCTGTTTTTGAGTTATGG + Intergenic
1146452240 17:32983768-32983790 ATGTTCCAGTTTGAGACTGAAGG + Intronic
1146620449 17:34393158-34393180 CTGTTCCTCTTATGGGGTGAAGG + Intergenic
1147030748 17:37633717-37633739 TTTTTCCTTTTTTAGTGTGAAGG - Intronic
1147697594 17:42367637-42367659 ATGTTGCTGTTTTAGATAGAGGG - Intronic
1150095370 17:62369908-62369930 TGGTTCCTGTGTTAGAGTGATGG + Intergenic
1150856423 17:68757522-68757544 GTGTTCCTCTGTGAGAATGAGGG + Intergenic
1152971001 18:160541-160563 CTGTGCCTCTTATAGAGTTAGGG + Intronic
1155347871 18:24876388-24876410 ATGTGGCTCTTTAATAGTGATGG + Intergenic
1155374608 18:25142085-25142107 ATGTTCCCTTTTTGGTGTGATGG - Intronic
1157083105 18:44549566-44549588 AGGTTCATCTTTTAGAGGGTAGG + Intergenic
1158763510 18:60419435-60419457 ATGTTTCCCTTTTAGAGGAATGG - Intergenic
1160305208 18:77727272-77727294 ATGTTCCTGTTTTAGAGATGAGG + Intergenic
1164699186 19:30270606-30270628 ATTCGCGTCTTTTAGAGTGATGG + Intronic
1164950418 19:32332001-32332023 AGGTTCCTGTTTTAGAGAAATGG - Intergenic
1166130207 19:40741525-40741547 CTGTTCCTCCTTCAGAGTGGAGG + Exonic
1166325778 19:42050249-42050271 AGTTTCCTCCTTTAAAGTGAGGG - Intronic
926001432 2:9336447-9336469 CTATTCCTCTTTTTGAGTGTTGG + Intronic
926256388 2:11204913-11204935 ATCTTCCTCTTTCAGATTGCAGG + Intronic
926399999 2:12487473-12487495 ATGTTCCCCTTTTAGAGGAGGGG - Intergenic
929426064 2:41845958-41845980 ATGTTCCTCTCTAAAAGTCAGGG - Intergenic
929610006 2:43263971-43263993 CTGTTCTTATTTTAGAGTGATGG - Intronic
932104367 2:68929090-68929112 ATGATCCTCTTTTAAACAGAAGG - Intergenic
932235267 2:70115783-70115805 ATGCTCGTGTTTTAGAATGAAGG - Intergenic
933042953 2:77492265-77492287 TTGTTTCTCTTTTAGAGATAGGG + Intronic
933770321 2:85739906-85739928 TTTTTCTTCTTTTAGAGTTAGGG - Intergenic
936033378 2:109089597-109089619 CTGTTTCTCTTTTAGAGACAAGG - Intergenic
938744958 2:134268787-134268809 ATGTCCCTCTTTTACAGGTAAGG + Intronic
939723858 2:145689424-145689446 CTGTTCCTGTGTTAGAATGATGG + Intergenic
942346462 2:175007533-175007555 TTGTTTCTCTTTTAGCATGATGG - Intergenic
942607991 2:177712122-177712144 TTGTTCCCTTTTTAGAGAGAAGG + Intronic
944718009 2:202394584-202394606 TTTTTCCTGTTTTAGAGTTAGGG + Intronic
944841158 2:203625011-203625033 ATATTACTCTTTTCGTGTGAAGG - Intergenic
945691767 2:213045420-213045442 ATGTTGCTCCTCTAGTGTGAAGG - Intronic
947337554 2:229103078-229103100 AGGTTCCTCTTTTTGAATCAGGG + Intronic
947945227 2:234095939-234095961 GTGTTTCTTTTTTAGAATGAAGG - Intergenic
1170317006 20:15053464-15053486 TTGTTCCTTTTATAGAGTGCAGG - Intronic
1174035815 20:47667710-47667732 ATGTGCCTCATTTAAAGAGAAGG + Intronic
1176153308 20:63604662-63604684 CTGTTCCTCATTTTGAGTGCAGG + Intronic
1177372434 21:20221606-20221628 ATCCTTCTCTTTTAGAGTTAAGG - Intergenic
1182247400 22:28969998-28970020 ATGTTCCTCTTCTCAAGTAATGG - Intronic
1182861106 22:33560170-33560192 ATGTTCCTATTTTAGAGATTTGG - Intronic
950604780 3:14068932-14068954 ATGTCCTTCCTATAGAGTGAAGG + Intronic
951582026 3:24174814-24174836 CTGTTCCTGTTTTAGAGATAAGG + Intronic
952164082 3:30727045-30727067 GTGTTCCTCTTTTAGCTTGAGGG - Exonic
952245069 3:31579098-31579120 ATGTTCCTCTTTTAGAGTGAGGG + Intronic
953017720 3:39094335-39094357 ATGTTTATGATTTAGAGTGAAGG + Intronic
959039615 3:101405961-101405983 GTGTTCCTCTTTTACACTGTTGG + Intronic
961970035 3:130953671-130953693 ATTCTGGTCTTTTAGAGTGATGG + Intronic
962435400 3:135361824-135361846 ATATTGCTCTTTTATAGAGATGG - Intergenic
962724792 3:138213454-138213476 ATTTTGCTCTTTTAGAGAAAAGG - Intronic
963809720 3:149763984-149764006 ATGTTCCTGTTTTACAGAAAGGG - Intronic
963851886 3:150217580-150217602 ATGATCCTCTCCTAGAGGGATGG + Intergenic
964235874 3:154526845-154526867 TTGTTCCACTTCTAGAGTGCAGG + Intergenic
969563456 4:7963883-7963905 ATGTAACTCATTTAGAGTTAAGG - Intergenic
973682784 4:53338491-53338513 TTGTTTCTCTTTTATAGTTAAGG - Intronic
974658630 4:64858168-64858190 ATGTTCCTGTTTCAAAGAGATGG + Intergenic
975109473 4:70607754-70607776 TTCTTCCTCTTGGAGAGTGAGGG - Intergenic
975972389 4:80056403-80056425 ATTTCCCACTTTTAGAGAGATGG - Intronic
976047428 4:80967722-80967744 ATGTTCATCTGTTAGAGATACGG - Intergenic
976986396 4:91304593-91304615 ACGTTCCTCTTTTATAATGGAGG + Intronic
977269506 4:94898766-94898788 ATGATCCTATTTTAGTGTGCTGG - Intronic
978172363 4:105688628-105688650 ATGTTTCTGTTTTACTGTGAGGG - Intronic
978207597 4:106096893-106096915 CAGTTCTTCTTTTAGAGTCAGGG - Intronic
979753378 4:124307265-124307287 ACAGTCTTCTTTTAGAGTGATGG - Intergenic
980056877 4:128086334-128086356 ATGTTCCTTTTTTTGAGACAGGG + Intronic
980482178 4:133401165-133401187 TGGTTCCACTTTTAGAGTGTAGG - Intergenic
981441536 4:144788823-144788845 GTGTTTTTCTGTTAGAGTGATGG - Intergenic
982045994 4:151446362-151446384 TAGTTCCTCTTTTAGATTGGTGG + Intronic
982840353 4:160176215-160176237 AAGTTCCACTGTTAGATTGATGG - Intergenic
983063387 4:163183000-163183022 ATGTTTTTCTTTTATAGAGATGG - Intergenic
983143891 4:164188577-164188599 ATATTCCCCTTCAAGAGTGAAGG - Intronic
985021066 4:185691203-185691225 TTGTTTCTTTTTTAGAGAGAGGG + Intronic
985303485 4:188513958-188513980 CTGTTTCTCTTTGAGAATGATGG + Intergenic
988333892 5:29879506-29879528 ATAATACTCTTTTATAGTGAAGG - Intergenic
989002439 5:36775225-36775247 ATGTTCCTCTCTTTGATTGTGGG + Intergenic
989256257 5:39368826-39368848 ATTTGACTCTTTTATAGTGAAGG + Intronic
991481114 5:67081186-67081208 AGGTTCCTATTTTAGAGGGAAGG + Intronic
992496585 5:77299886-77299908 ATGTTCCACTTTTACACTGTTGG - Intronic
992628339 5:78655399-78655421 ATGTTTCTTTTTTAAATTGAGGG - Intronic
993002093 5:82391562-82391584 ATGTTCCCCTCATAGAGAGAAGG - Intergenic
994150310 5:96440211-96440233 ATTTTCCCCTTATAGAGTTAAGG - Intergenic
994822645 5:104673971-104673993 ATTTTTTTCTTTTAGAGAGAGGG + Intergenic
995297409 5:110537657-110537679 ATGTTCTCCTTTGAGTGTGAGGG - Intronic
996303685 5:122021383-122021405 ATCTTCACATTTTAGAGTGAAGG + Intronic
1003974901 6:11333211-11333233 ATGTTCCTCTTTTAATCTCATGG - Intronic
1004054748 6:12124048-12124070 ATGTGCCTCTCTTAGAAAGAAGG + Exonic
1005953946 6:30650412-30650434 ATGTTCCTCATTTTGGGTTAAGG + Intronic
1007605191 6:43112998-43113020 TTTTTCTTCTTTTAGAGTCAGGG + Intronic
1008029111 6:46673295-46673317 ATATCCCTCTTTTATAGAGAAGG + Intronic
1008446794 6:51600976-51600998 ATGTCCTTGTTTTAGAGAGAAGG - Intergenic
1010535201 6:77018266-77018288 ATGTTGCTCCTATAAAGTGAGGG + Intergenic
1010859290 6:80886595-80886617 TTCTTCCTATTTGAGAGTGAAGG + Intergenic
1012213245 6:96550608-96550630 CTGTTCCTCTGTTTGAGGGATGG - Intronic
1012381476 6:98624571-98624593 ATGTCCTTCTTTTTGAGTGTGGG - Intergenic
1012939901 6:105404520-105404542 ATGTCCCTATTTTATAGTTAAGG + Intergenic
1013042351 6:106448336-106448358 CAGTTCCTGTTTTAGAATGATGG + Intergenic
1013153246 6:107467078-107467100 ATGTTCATATTTTTAAGTGATGG + Intergenic
1014427564 6:121327263-121327285 ATTTTCCTTTTTTAGATTCATGG - Intronic
1016174715 6:141066842-141066864 TTTTTCCTCTTTTATAGTGAAGG + Intergenic
1017316328 6:153035780-153035802 ATGCTCCTCCTTCAGGGTGAAGG - Intronic
1017449311 6:154539428-154539450 ATGGGCCTCTTTTATAGAGAAGG + Intergenic
1018879391 6:167861560-167861582 AGTTTCCTTTTTTACAGTGAAGG + Intronic
1019027945 6:168987127-168987149 ATGTTGCTCTTCTGGAGTAAGGG - Intergenic
1020027199 7:4907520-4907542 ATGGTCTTCTTCAAGAGTGACGG - Exonic
1022056970 7:26747110-26747132 TTAGTCCTCTTTTAGAGTTACGG - Intronic
1022594808 7:31703074-31703096 ATGGTCCCCTTTTAGATTTATGG - Intronic
1025620423 7:63165217-63165239 ATGTTACTCTTATTGGGTGATGG + Intergenic
1026274335 7:68863579-68863601 ATGTTCCTCCTTTCTAGTGGTGG + Intergenic
1027913588 7:84284787-84284809 ATGTTCCTTTTTTTGATTGATGG + Intronic
1028874471 7:95805406-95805428 CTGTTCTTCTCTTAGAGAGAAGG + Intronic
1029674912 7:102061853-102061875 ATGTTACTCTCTTAGAGATATGG + Intronic
1031751700 7:125582874-125582896 ATCATCTTCTTTTTGAGTGAAGG + Intergenic
1033912729 7:146285558-146285580 ATCTTTCTCTTTTGGAGTGGAGG + Intronic
1034380843 7:150691116-150691138 ATGTTCCTCCCTTACAGTAAAGG + Intronic
1037980366 8:23249118-23249140 AAATTCCTCTTTTAGGGTAAAGG + Intronic
1039294734 8:36138157-36138179 ATGTCCCTCATTTAGGGTGAAGG + Intergenic
1040631631 8:49219971-49219993 ATATTCCTCTGGTAAAGTGATGG - Intergenic
1041346840 8:56907925-56907947 AATTTCATCTTTTAGTGTGAAGG - Intergenic
1041502587 8:58554353-58554375 ATTTTCCTGTTTAAGATTGAGGG + Intronic
1046622304 8:116541213-116541235 TTGTGCCTCCTTTGGAGTGAAGG - Intergenic
1047822672 8:128538697-128538719 TTGTTCCTCTCCTAGAGGGAAGG - Intergenic
1048178685 8:132175753-132175775 ATGATCCCATTTTACAGTGATGG - Intronic
1050118187 9:2281735-2281757 ATGTTCTTATTTGAGACTGATGG + Intergenic
1051043801 9:12849020-12849042 ATGTTCCCCTTCTTGTGTGATGG - Intergenic
1052529509 9:29663050-29663072 ATATTCCTGTTTTAAAGTGCTGG - Intergenic
1055288863 9:74761541-74761563 TTGTTCCTCTTTTTAAGAGATGG - Intronic
1055309936 9:74968098-74968120 ATGTTGCTGTTTTAGAGACAGGG - Intergenic
1056291248 9:85145828-85145850 CTGATGCTCTTTTTGAGTGATGG - Intergenic
1057473471 9:95379188-95379210 ATTTTACTTTTTTAGAGTGAGGG + Intergenic
1058901404 9:109445735-109445757 ATGTTACTATTTTAGAAAGAGGG - Intronic
1059017931 9:110542320-110542342 AATTTCCTCTTGTAGAATGAGGG + Intronic
1059182198 9:112227220-112227242 ATCTTTCTATTTTAGAGTGTAGG + Intronic
1059261647 9:112982770-112982792 ATGTACCCATTTTACAGTGAAGG - Intergenic
1059698014 9:116747216-116747238 TTGTTCTACTTTTATAGTGAGGG + Intronic
1059967945 9:119634531-119634553 ATGTTCCCATTTTAGAGAGGAGG - Intergenic
1060607686 9:124931570-124931592 TTCTTCCTCTTATAAAGTGAAGG + Intronic
1189106288 X:38239043-38239065 ATATTCCTCTTTAGGATTGAAGG - Intronic
1189735513 X:44066046-44066068 GTGTTCCTCTTTTACACTGTTGG - Intergenic
1191935649 X:66424343-66424365 CTCTTCCCCTTTTAAAGTGAGGG - Intergenic
1192377785 X:70581672-70581694 ATTTTCCTCTTTAAAAGGGATGG + Intronic
1193475039 X:81953292-81953314 AGTTTCCTCTTAAAGAGTGAAGG + Intergenic
1194016807 X:88631853-88631875 AAGTTCTTCTTTTATAGTGTAGG - Intergenic
1194996100 X:100593100-100593122 AATTGCCTCTTTTAGAGTGCAGG + Intronic
1196499883 X:116367547-116367569 ATGTTCCTCATTTGGTGTGCAGG - Intergenic
1197794063 X:130282037-130282059 GTGTTCCTCTCTGAGTGTGAGGG - Intergenic
1198127435 X:133659742-133659764 ATATTCCTCATTTAGAATTAGGG + Intronic
1198696006 X:139339028-139339050 ATGTTCCTCTTTTTCAGGGCTGG + Intergenic