ID: 952246245 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:31595781-31595803 |
| Sequence | CCTGCTACTGAATCCACTGT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 138 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 10, 4: 127} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 952246240_952246245 | 3 | Left | 952246240 | 3:31595755-31595777 | CCACACCTATACTTCTTCCATCT | 0: 1 1: 0 2: 3 3: 25 4: 280 |
||
| Right | 952246245 | 3:31595781-31595803 | CCTGCTACTGAATCCACTGTGGG | 0: 1 1: 0 2: 0 3: 10 4: 127 |
||||
| 952246241_952246245 | -2 | Left | 952246241 | 3:31595760-31595782 | CCTATACTTCTTCCATCTGTGCC | 0: 1 1: 0 2: 2 3: 21 4: 234 |
||
| Right | 952246245 | 3:31595781-31595803 | CCTGCTACTGAATCCACTGTGGG | 0: 1 1: 0 2: 0 3: 10 4: 127 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 952246245 | Original CRISPR | CCTGCTACTGAATCCACTGT GGG | Intronic | ||