ID: 952246245

View in Genome Browser
Species Human (GRCh38)
Location 3:31595781-31595803
Sequence CCTGCTACTGAATCCACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952246240_952246245 3 Left 952246240 3:31595755-31595777 CCACACCTATACTTCTTCCATCT 0: 1
1: 0
2: 3
3: 25
4: 280
Right 952246245 3:31595781-31595803 CCTGCTACTGAATCCACTGTGGG 0: 1
1: 0
2: 0
3: 10
4: 127
952246241_952246245 -2 Left 952246241 3:31595760-31595782 CCTATACTTCTTCCATCTGTGCC 0: 1
1: 0
2: 2
3: 21
4: 234
Right 952246245 3:31595781-31595803 CCTGCTACTGAATCCACTGTGGG 0: 1
1: 0
2: 0
3: 10
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952246245 Original CRISPR CCTGCTACTGAATCCACTGT GGG Intronic