ID: 952248408

View in Genome Browser
Species Human (GRCh38)
Location 3:31623816-31623838
Sequence GACTACACTTGGACTAGAGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 73}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952248408_952248412 0 Left 952248408 3:31623816-31623838 CCTACTCTAGTCCAAGTGTAGTC 0: 1
1: 0
2: 1
3: 0
4: 73
Right 952248412 3:31623839-31623861 CTGGCCTCATACAATCATGATGG 0: 1
1: 0
2: 1
3: 23
4: 513
952248408_952248413 1 Left 952248408 3:31623816-31623838 CCTACTCTAGTCCAAGTGTAGTC 0: 1
1: 0
2: 1
3: 0
4: 73
Right 952248413 3:31623840-31623862 TGGCCTCATACAATCATGATGGG 0: 1
1: 0
2: 1
3: 10
4: 121
952248408_952248415 17 Left 952248408 3:31623816-31623838 CCTACTCTAGTCCAAGTGTAGTC 0: 1
1: 0
2: 1
3: 0
4: 73
Right 952248415 3:31623856-31623878 TGATGGGTAAGAAAATAACTCGG 0: 1
1: 0
2: 3
3: 22
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952248408 Original CRISPR GACTACACTTGGACTAGAGT AGG (reversed) Exonic
913079965 1:115374601-115374623 GACTAGACATTGACTAGAGGTGG - Intergenic
920000100 1:202791557-202791579 TGCTTCACTTGGATTAGAGTAGG - Intronic
923628048 1:235630106-235630128 TACTACAATAGGATTAGAGTTGG + Intronic
1063825405 10:9891731-9891753 GAGTACACTTGGGTTAGGGTAGG - Intergenic
1065623286 10:27605710-27605732 GAAAACACTTGGACTGGGGTAGG + Intergenic
1069133681 10:64737098-64737120 GAATACACATGGACCAAAGTAGG - Intergenic
1072880691 10:99224959-99224981 GACTACACTGTGACTAGACATGG + Intronic
1078010171 11:7566919-7566941 GACTACGAATAGACTAGAGTGGG - Intronic
1078063847 11:8065118-8065140 GACTACACCTGGACTTGGGAAGG + Intronic
1078295850 11:10069349-10069371 GAGAACACTTGGAATAGGGTGGG - Intronic
1080487365 11:32723983-32724005 GAATATATTTGTACTAGAGTAGG - Intronic
1081175043 11:39917409-39917431 GCCTACACTTGGCCTACATTTGG - Intergenic
1091750761 12:3020104-3020126 AACTACAGTAGGACTGGAGTAGG + Intronic
1102220256 12:111189324-111189346 GATTAGACATGGACTAGAATGGG - Intronic
1107704526 13:43087333-43087355 CACTACACTTTTACTAGAGCAGG - Intronic
1123956123 15:25336319-25336341 GACTACACAGGGACTAGTCTTGG + Intronic
1126439646 15:48673685-48673707 GGCAGAACTTGGACTAGAGTTGG - Intergenic
1127876697 15:63118054-63118076 GACTACACATGGAGAAGAATGGG - Intergenic
1133568539 16:7018828-7018850 CACTGCACCTGGCCTAGAGTGGG - Intronic
1135683103 16:24475592-24475614 GACAACAGTTGGACTGGATTAGG + Intergenic
1142746501 17:1961588-1961610 GAGCACACTAGGACAAGAGTGGG - Intronic
1150140217 17:62721992-62722014 CACTACACCTGGCCGAGAGTTGG - Intronic
1150309081 17:64112827-64112849 CACTCCAATTAGACTAGAGTTGG - Intronic
1155055939 18:22183894-22183916 GACTACACTGAGACAAGATTAGG + Intronic
1155904091 18:31428610-31428632 GATTACAATGGGCCTAGAGTAGG - Intergenic
925654219 2:6127726-6127748 CACCACACTTGGACTGCAGTTGG + Intergenic
931836593 2:66105425-66105447 GATGACACTTGGCCTAAAGTTGG - Intergenic
937483966 2:122294328-122294350 GACTCCATTTGGGCTAGGGTGGG + Intergenic
938205896 2:129422988-129423010 GGCTATACTTGGGCAAGAGTGGG - Intergenic
942529097 2:176889249-176889271 GACTATTCTTGGAGTAGGGTGGG - Intergenic
943168042 2:184357463-184357485 GACTAGACTGGGTGTAGAGTGGG + Intergenic
944534891 2:200698981-200699003 GACTACACTTTGAGAAGCGTTGG + Intergenic
1174498476 20:50966511-50966533 GGCCACACTAGGACTAGAATGGG + Intergenic
1178426877 21:32485691-32485713 GTCTCCACTTAGACAAGAGTGGG - Intronic
1178817848 21:35947675-35947697 GAATATTCTTGGACTATAGTAGG - Intronic
1179119170 21:38527262-38527284 GACCACACTTGGAATAGCGCTGG - Intronic
1179520847 21:41943401-41943423 GACAAGACTTGGACAAGACTTGG - Intronic
1182340672 22:29618033-29618055 GACTATAATTGGCCTAAAGTAGG + Intronic
952248408 3:31623816-31623838 GACTACACTTGGACTAGAGTAGG - Exonic
954850463 3:53595597-53595619 GACAACAGTGGGTCTAGAGTCGG - Intronic
955907091 3:63818414-63818436 GACTGCACTTGGAGTAGTGAGGG - Intergenic
960151488 3:114253144-114253166 GACTCCACTTGGAGTAGAAATGG + Intergenic
960226171 3:115171895-115171917 GGCTTCATTTGGAGTAGAGTCGG - Intergenic
962215605 3:133518413-133518435 CACTACACCTGCACTACAGTGGG + Intergenic
968742492 4:2338297-2338319 TACTGCACCTGGCCTAGAGTTGG - Intronic
972600892 4:40571657-40571679 GACTACACTTTGGATACAGTGGG + Intronic
975717776 4:77221671-77221693 GCCTACACTTGTGCCAGAGTTGG - Intronic
975885740 4:78962613-78962635 GACTTCACTTGGATTTGAATAGG + Intergenic
980940771 4:139272074-139272096 GCCTACACCTCAACTAGAGTGGG + Intronic
981212185 4:142120639-142120661 GACTTGACTTGGATTGGAGTAGG - Intronic
988848290 5:35152588-35152610 GACAATACTTGTACTAGTGTGGG - Intronic
989255051 5:39357654-39357676 GACTGCCCTAGGACTGGAGTTGG + Intronic
991328141 5:65461170-65461192 TACTCCATTTGGACTAGAGAAGG - Intronic
993043524 5:82841919-82841941 GAGAACACTTGGACAAGTGTGGG - Intergenic
996845380 5:127893460-127893482 GAACACACTTGGACTGCAGTGGG - Intergenic
997773308 5:136574508-136574530 GACTATGCTTCAACTAGAGTTGG + Intergenic
1002666568 5:180829969-180829991 GACTTCACTTGAAGTAAAGTGGG - Intergenic
1003663178 6:8084022-8084044 GCCTGCACTTGGACTAGAGTGGG + Intronic
1007178287 6:39911191-39911213 GAATTGACTTGGACTAGAGGTGG - Intronic
1007626459 6:43249160-43249182 GAATAGAGTTGGACTAGAATTGG - Intronic
1010514204 6:76753422-76753444 GCCTCCCCTTGGACTAGAGCAGG - Intergenic
1020434370 7:8146944-8146966 GGCTTCACTTTGACCAGAGTTGG - Intronic
1024637076 7:51299981-51300003 GACCACACCTGGACTAGTGCTGG + Intronic
1026448541 7:70506856-70506878 GACTCCACATGGCCCAGAGTAGG - Intronic
1027351601 7:77317325-77317347 GAGAACACTTGGACAAGGGTTGG + Intronic
1028133357 7:87202897-87202919 GACTGCACTTGGGCCAGAGAAGG + Intronic
1033521431 7:142164983-142165005 GACAACGCTTGGACTGGAGGTGG - Intronic
1033865091 7:145680652-145680674 GCCAACACTTGGACATGAGTTGG + Intergenic
1034555559 7:151848302-151848324 GACTTCACATGGACAAAAGTAGG - Intronic
1038931996 8:32203703-32203725 AAATACACTTGGCCTATAGTAGG - Intronic
1046590485 8:116200151-116200173 GAATACACTTTGAGTAAAGTGGG - Intergenic
1048831290 8:138479747-138479769 CACTGGACTTGGACTATAGTAGG + Intronic
1050098052 9:2087944-2087966 GACTAAACTTGAACTAGATAGGG + Intronic
1057246864 9:93463537-93463559 TTCTTCAGTTGGACTAGAGTAGG + Intronic
1060883917 9:127137281-127137303 GACTCCAACTGGCCTAGAGTGGG - Intronic