ID: 952248408

View in Genome Browser
Species Human (GRCh38)
Location 3:31623816-31623838
Sequence GACTACACTTGGACTAGAGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 73}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952248408_952248413 1 Left 952248408 3:31623816-31623838 CCTACTCTAGTCCAAGTGTAGTC 0: 1
1: 0
2: 1
3: 0
4: 73
Right 952248413 3:31623840-31623862 TGGCCTCATACAATCATGATGGG 0: 1
1: 0
2: 1
3: 10
4: 121
952248408_952248412 0 Left 952248408 3:31623816-31623838 CCTACTCTAGTCCAAGTGTAGTC 0: 1
1: 0
2: 1
3: 0
4: 73
Right 952248412 3:31623839-31623861 CTGGCCTCATACAATCATGATGG 0: 1
1: 0
2: 1
3: 23
4: 513
952248408_952248415 17 Left 952248408 3:31623816-31623838 CCTACTCTAGTCCAAGTGTAGTC 0: 1
1: 0
2: 1
3: 0
4: 73
Right 952248415 3:31623856-31623878 TGATGGGTAAGAAAATAACTCGG 0: 1
1: 0
2: 3
3: 22
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952248408 Original CRISPR GACTACACTTGGACTAGAGT AGG (reversed) Exonic