ID: 952250481

View in Genome Browser
Species Human (GRCh38)
Location 3:31648489-31648511
Sequence CAGCCACCTGTGGAATGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952250481_952250485 6 Left 952250481 3:31648489-31648511 CCAAAGCATTCCACAGGTGGCTG No data
Right 952250485 3:31648518-31648540 ATACTCCTGCCTACCATGGTTGG No data
952250481_952250484 2 Left 952250481 3:31648489-31648511 CCAAAGCATTCCACAGGTGGCTG No data
Right 952250484 3:31648514-31648536 AAGCATACTCCTGCCTACCATGG No data
952250481_952250489 26 Left 952250481 3:31648489-31648511 CCAAAGCATTCCACAGGTGGCTG No data
Right 952250489 3:31648538-31648560 TGGCACCTGAACTCACCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952250481 Original CRISPR CAGCCACCTGTGGAATGCTT TGG (reversed) Intergenic
No off target data available for this crispr