ID: 952251791

View in Genome Browser
Species Human (GRCh38)
Location 3:31663149-31663171
Sequence AGTCAGGGGTTACCAGCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952251786_952251791 -7 Left 952251786 3:31663133-31663155 CCCTCTTTGTAGCAGAAGTCAGG 0: 1
1: 0
2: 0
3: 22
4: 266
Right 952251791 3:31663149-31663171 AGTCAGGGGTTACCAGCACCTGG 0: 1
1: 0
2: 1
3: 10
4: 143
952251788_952251791 -8 Left 952251788 3:31663134-31663156 CCTCTTTGTAGCAGAAGTCAGGG 0: 1
1: 0
2: 1
3: 10
4: 144
Right 952251791 3:31663149-31663171 AGTCAGGGGTTACCAGCACCTGG 0: 1
1: 0
2: 1
3: 10
4: 143
952251785_952251791 15 Left 952251785 3:31663111-31663133 CCTCGTATATAGACAGAATAATC 0: 1
1: 0
2: 1
3: 4
4: 63
Right 952251791 3:31663149-31663171 AGTCAGGGGTTACCAGCACCTGG 0: 1
1: 0
2: 1
3: 10
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952251791 Original CRISPR AGTCAGGGGTTACCAGCACC TGG Intronic
900311966 1:2037840-2037862 AGCCAAGGATTGCCAGCACCAGG + Intergenic
901877895 1:12177378-12177400 AGCCAGCGGTGACCAGGACCGGG - Intronic
905517432 1:38572134-38572156 AGCCAGGGGTGACCAGCACAGGG - Intergenic
906026699 1:42680413-42680435 AGCCAGTAGTTACAAGCACCTGG + Intergenic
909596985 1:77417159-77417181 AGTAAGGGGTTTCCAGAAACAGG - Intronic
910263520 1:85314399-85314421 AGTCAGAGGATATCAGCACAAGG - Intergenic
914976823 1:152373128-152373150 GGTCAGTGGTTACCAGAACCTGG + Intergenic
915166114 1:153948587-153948609 AGCCAGGGGGATCCAGCACCAGG + Exonic
915292558 1:154896463-154896485 AGGCAGGGGTGACCGGCCCCAGG + Intergenic
916976449 1:170085206-170085228 AAACAGTGGTTACCACCACCAGG - Intronic
918225179 1:182474689-182474711 AGGCAGGGGTCCCCAGCCCCTGG + Intronic
920684841 1:208101584-208101606 AGTCACGGCTGACCTGCACCAGG + Intronic
922057283 1:222053220-222053242 GTCCAGGGGTCACCAGCACCTGG + Intergenic
924124044 1:240831334-240831356 ATTCAGGGGTTATCAGCACTGGG - Intronic
924558103 1:245134499-245134521 AGTCAGGGGAGAGCAGCACGAGG - Intergenic
924699711 1:246439012-246439034 AGTCAGGGGTCCCCAGAGCCCGG - Intronic
1063235088 10:4105687-4105709 AGTCAGAGGTCCCCAGCCCCTGG - Intergenic
1065226504 10:23549042-23549064 CATCAGGGGTTCCCAGCCCCTGG + Intergenic
1067706279 10:48608560-48608582 GCCCAGGGGTCACCAGCACCTGG + Intronic
1067748127 10:48951968-48951990 AGTCAGCTGTTACCAGCAGTGGG + Intronic
1068350895 10:55843645-55843667 AGTCATGGGTCACCAACACCTGG + Intergenic
1069561505 10:69434051-69434073 AGACAGTGGTTACCAGGAGCTGG - Intergenic
1071684793 10:87743455-87743477 AGAGAGGGGCTACAAGCACCCGG + Exonic
1072942376 10:99778027-99778049 AAGCAGGGGTCCCCAGCACCTGG + Intergenic
1074768404 10:116717352-116717374 AGTCAGGAGTCACCATCACAGGG + Intronic
1075713285 10:124542128-124542150 AGTTAGAGCTGACCAGCACCTGG + Intronic
1076166485 10:128286620-128286642 AGCAAGGCTTTACCAGCACCTGG + Intergenic
1076594794 10:131618901-131618923 GGTCAGGGGGTCCCAGCACTAGG + Intergenic
1081254772 11:40878664-40878686 AGTCAGGGATTCCCAACCCCTGG - Intronic
1083266736 11:61550407-61550429 AGGCAGGGGAGACCAGCAGCGGG + Intronic
1084661306 11:70548136-70548158 CGGCAGGGGTTGCCAGCATCCGG + Intronic
1086676402 11:89612417-89612439 AGTCAATTGGTACCAGCACCAGG - Intergenic
1088881495 11:113976756-113976778 AGCCAGGCCTTGCCAGCACCTGG + Intronic
1089851535 11:121501386-121501408 GGTTAGTGGTTACCAGCATCAGG - Intronic
1092654638 12:10672224-10672246 AGCCAGAGGTCACCAACACCCGG + Intronic
1096041833 12:48523968-48523990 AGGTAGGGATTACCAGCAGCAGG + Intronic
1098314413 12:69178031-69178053 GGTCAGGGGTCCCCAGCCCCTGG - Intergenic
1102531967 12:113553331-113553353 ATTGAATGGTTACCAGCACCAGG - Intergenic
1104079531 12:125417821-125417843 AGCCAGTGGTGACCAGCACTGGG - Intronic
1104356884 12:128094815-128094837 AGCCAGGGGATCCCAGCACTGGG - Intergenic
1104722239 12:131050997-131051019 ACACAGGGGTTCCCAACACCCGG - Intronic
1105005421 12:132718225-132718247 AGTCAGGCCTCACCAGCCCCCGG + Intronic
1105070613 12:133232265-133232287 AGTCACGGGAGACCAGCACCAGG - Intronic
1105574402 13:21636773-21636795 ATTCAGGGATTAGCAACACCAGG - Intergenic
1106409938 13:29504573-29504595 AGCCAGGGGGCACCAGCTCCTGG + Exonic
1108588914 13:51895188-51895210 AGTCAGGGGTCCCCAGCCCCTGG - Intergenic
1109210502 13:59530011-59530033 AGTCTGGTGTTACCTACACCAGG - Intergenic
1112397978 13:99050857-99050879 ATCCAAGGGTTACCAACACCTGG - Intronic
1112846250 13:103647283-103647305 AGGCATGGGTTACCACCACCAGG - Intergenic
1114333339 14:21660339-21660361 ATTCTGGGGTCCCCAGCACCTGG - Intergenic
1115786296 14:36829511-36829533 ATCCTGGGGCTACCAGCACCAGG - Intronic
1118974129 14:70662974-70662996 AGGCAGAGGTGACCAGCAGCAGG - Intronic
1120690797 14:87590330-87590352 AGTCAGCTGTTATCAACACCAGG + Intergenic
1123625940 15:22226832-22226854 TGTCAGGGGTTATCAGAAGCAGG + Intergenic
1126134335 15:45376533-45376555 AGTCAGAGGGTAGCAGCAGCAGG + Intronic
1127592742 15:60442899-60442921 AGTCAGTGCTTCCCAGCATCTGG - Intronic
1133234899 16:4383184-4383206 AGGCATGCGTTACCAGCACATGG - Exonic
1135105526 16:19645987-19646009 AGACAGGGGTTTCCAACTCCTGG + Intronic
1136102608 16:28006955-28006977 AGCCAGGGGTTATCTGCGCCTGG + Intronic
1136186391 16:28591140-28591162 AGTCAGTGGCTTCCAGCCCCAGG + Intronic
1136390216 16:29959564-29959586 AGTCAGGGGTCCCCAACCCCTGG - Intronic
1137757439 16:50913891-50913913 AGGCAGGGCTTATGAGCACCAGG - Intergenic
1138619682 16:58201094-58201116 TGTCAGGGGTTCCCAGAACTGGG - Intergenic
1141836510 16:86543719-86543741 AGACAGGGGTTCCCAACTCCTGG + Intronic
1142123914 16:88400853-88400875 AGACAGTGGTTACCACCACTAGG + Intergenic
1142805197 17:2367788-2367810 AGTCAGGAGTCAGAAGCACCAGG - Intronic
1148778619 17:50109627-50109649 AGTCAAGGGTTCCCAGCACAGGG - Intronic
1150208998 17:63431329-63431351 AGTCAGAGGTCCCCAGCCCCAGG + Intergenic
1150493427 17:65589806-65589828 AGACATGAGTTACCAGCACTGGG + Intronic
1152621118 17:81365364-81365386 AGTCAGGGGTCCCCAACCCCTGG - Intergenic
1153884558 18:9452083-9452105 AGTCAGGAGTTATCAGCACCTGG - Intergenic
1154302488 18:13206639-13206661 AGCCAGGGTTTTCCAGCAACTGG - Intergenic
1156001926 18:32394771-32394793 AGGCAGGAATTACAAGCACCAGG + Intronic
1156419068 18:36931206-36931228 GGTCAGGGGTCCCCAGCCCCTGG + Intronic
1157041563 18:44045662-44045684 ACTAAAGGGTTACCAGGACCTGG - Intergenic
1158185823 18:54770170-54770192 AGACAGGGGTTGCCAACACCTGG + Intronic
1161325008 19:3659330-3659352 ATTCGGGGGTCACCAACACCGGG + Intronic
1162605923 19:11707981-11708003 CCTCAGGGGTTGCCAGCACTTGG + Intergenic
1163410492 19:17150876-17150898 AGTCTGAGGGTACCAGCACAGGG - Intronic
1165485452 19:36092808-36092830 AGGCAGGGGCTGCCAGGACCTGG - Exonic
1165714178 19:38033817-38033839 GGTCAGGGGTTCTCAGCAGCGGG + Intronic
926046878 2:9716482-9716504 AGTGAAGACTTACCAGCACCTGG - Intergenic
927195259 2:20542378-20542400 AGTCAGGGGTGAGGAGAACCGGG - Intergenic
932717282 2:74110779-74110801 AGTCAGGGGTACCGAGCAGCAGG - Intergenic
933125249 2:78596827-78596849 AGGAAGCGGTTACCAGAACCTGG + Intergenic
938449564 2:131405027-131405049 AGTCAGGGGTTCCCAAACCCTGG - Intergenic
942477611 2:176344616-176344638 ATTCAGGGGTTCCCAACTCCTGG + Intergenic
943299323 2:186177968-186177990 AGGGAAGGGTTACCAGAACCTGG - Intergenic
945875443 2:215273449-215273471 AGTCAGGGCTTACAAACACTAGG - Intergenic
946072619 2:217047586-217047608 AGTCAGGGCCTCCCAGAACCAGG + Intergenic
948761751 2:240196750-240196772 AGCCAGGGGCCACCAGAACCTGG + Intergenic
1168849393 20:966150-966172 AGTCAGGGGCCATCAGCAGCTGG + Intronic
1171021300 20:21586689-21586711 AGACAGGGATTGGCAGCACCAGG - Intergenic
1175140973 20:56860070-56860092 ACTGAGGGGTTCCCAGAACCTGG - Intergenic
1175455435 20:59109154-59109176 AGCCAGGCCTTACCAGCAACTGG - Intergenic
1176235419 20:64051416-64051438 AGTCAGGGGTCACCAGGGCCTGG + Intronic
1182146790 22:28001595-28001617 AGGCAGGGGTTTCAGGCACCAGG + Intronic
1183322993 22:37176443-37176465 AGGCGGTGGTGACCAGCACCTGG - Intergenic
1184490393 22:44804964-44804986 TGTCTGGGGTAATCAGCACCAGG - Intronic
950454141 3:13082735-13082757 AGCCAAGGGTGACCAGCACTGGG - Intergenic
950589054 3:13922322-13922344 AGACAGGGGTTCCCAACCCCTGG - Intergenic
950994566 3:17481032-17481054 AGTCAGGGGCTCCCTGAACCAGG + Intronic
951100978 3:18688161-18688183 AGTCAGTAGTTACCAGGAGCTGG + Intergenic
952251791 3:31663149-31663171 AGTCAGGGGTTACCAGCACCTGG + Intronic
955144007 3:56298193-56298215 AATCAGTGGTTACCAGGGCCTGG - Intronic
960957041 3:123039950-123039972 ACTCAGGGATCCCCAGCACCAGG + Intergenic
962583339 3:136818225-136818247 AGTTAGTGGTAACCAGAACCTGG + Intergenic
965243569 3:166234687-166234709 TGTCAGGGGATAACAGCAGCTGG - Intergenic
968189395 3:196656679-196656701 ATTCAGGGGTTACCAGGCACAGG + Intronic
972354470 4:38267519-38267541 AACCTGGGGTTAGCAGCACCAGG + Intergenic
974078180 4:57186577-57186599 AATCAGGGGTCCCCAGCCCCTGG - Intergenic
975111896 4:70637784-70637806 TCTCAGAGGTTACCACCACCAGG + Exonic
976172623 4:82319736-82319758 AGTCAGTGGTTGCCAGTGCCTGG + Intergenic
977369440 4:96116352-96116374 TGTCAGGGGCTACCAGCCACAGG - Intergenic
979559768 4:122088847-122088869 GTTCAGGGGTCACCACCACCTGG + Intergenic
980886374 4:138766986-138767008 ACTCAGGGGTCCCCAGCCCCTGG - Intergenic
981164635 4:141542646-141542668 AAGCAGGGGTTCCCAGCCCCTGG - Intergenic
981269031 4:142822350-142822372 AAGCAGGGGTTCCCAGCCCCTGG + Intronic
982105992 4:152012571-152012593 AGTCAGGGGTCCCCAACCCCAGG + Intergenic
982563198 4:156956612-156956634 GGTCATAGGTAACCAGCACCTGG + Intronic
985344177 4:188985511-188985533 AATCAGGGGTCCCCAGCCCCTGG - Intergenic
985526145 5:403007-403029 AGTCAGTGGTTACCAGGGGCCGG + Intronic
995491339 5:112694981-112695003 AATCAGTGGTTGCCAGCAGCTGG + Intergenic
1002453328 5:179331619-179331641 AGGGAGGGGCTCCCAGCACCAGG + Intronic
1004591369 6:17054948-17054970 AGTCATGTGTTACCAGGCCCTGG + Intergenic
1005105887 6:22223723-22223745 GGTCTTGTGTTACCAGCACCTGG + Intergenic
1005408812 6:25520869-25520891 ATTCAGAGGTTTCCAGCACAGGG - Intronic
1005461082 6:26070989-26071011 AGTCTGGGGATACCAGAAGCTGG - Intergenic
1007090687 6:39183047-39183069 AGCCAGGTGTTCCCAGAACCTGG + Intergenic
1017318280 6:153058000-153058022 AGTCAGGGGTCCCCAACCCCTGG - Intronic
1018443580 6:163834820-163834842 ACTCACGGGCTCCCAGCACCCGG + Intergenic
1018783386 6:167089606-167089628 AGTCAGGGGAGGCCAGAACCAGG + Intergenic
1019119699 6:169793019-169793041 AGCTTGGGGTTTCCAGCACCTGG - Intergenic
1021992562 7:26152330-26152352 CGTCGCGGGTTCCCAGCACCGGG - Exonic
1024951917 7:54871278-54871300 AGTCAGTGGTTTCCAGGAGCTGG - Intergenic
1025194915 7:56925240-56925262 AGGCAGGGGCTCCCAGCTCCAGG + Intergenic
1025677037 7:63651703-63651725 AGGCAGGGGCTCCCAGCTCCAGG - Intergenic
1029679189 7:102096261-102096283 AGTCAGGGGTTAGCGGCCGCAGG - Intronic
1030580552 7:111349640-111349662 AGTCAGGTGGTACCAGCAAGGGG + Intronic
1031937172 7:127747600-127747622 TGACAGGAGTTATCAGCACCTGG + Intronic
1031944335 7:127823302-127823324 AGTCAGGGGAACCAAGCACCTGG - Intronic
1032004418 7:128288797-128288819 AGTCTGGGGCTACCAGAAGCTGG + Intergenic
1036655130 8:10672874-10672896 GGCCAGGGCTTACCAGCCCCTGG + Intronic
1039730586 8:40272164-40272186 ATGCAGGGGTTCCCAGCTCCCGG + Intergenic
1041254979 8:55972184-55972206 AGTCACGGGTCAGCAGCAGCCGG + Intronic
1045992067 8:108319650-108319672 AGTCAGTGGTTACCAGGAGTTGG - Intronic
1055816986 9:80218419-80218441 AATCAGGGGTCCCCAGCTCCTGG + Intergenic
1056115082 9:83433933-83433955 AGGCAGGGGTCCCCAGCCCCTGG - Intronic
1057969226 9:99537672-99537694 AGTCAGTGGTTACCGGAATCTGG + Intergenic
1059795724 9:117694414-117694436 AGTCAGAGGTCCCCAGTACCTGG + Intergenic
1062667682 9:137685273-137685295 TATCAGGGGTTACCAGGAGCTGG - Intronic
1189382584 X:40512473-40512495 AGGCAGGGGTTCCCAACCCCAGG + Intergenic
1196177741 X:112659086-112659108 TGACAGTGGTTACCAGCAGCTGG + Intronic
1197419265 X:126217777-126217799 AGTCTGGGGCTACCAGAAGCTGG + Intergenic
1201951366 Y:19567651-19567673 AGACGGTGGTGACCAGCACCGGG - Intergenic