ID: 952258375

View in Genome Browser
Species Human (GRCh38)
Location 3:31714831-31714853
Sequence CTGGAGCAGAAGGATGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 532
Summary {0: 1, 1: 0, 2: 6, 3: 46, 4: 479}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952258375 Original CRISPR CTGGAGCAGAAGGATGAGCT GGG (reversed) Intronic
900499847 1:2998652-2998674 CTGGAGCAGGAGGAGGGGCAGGG + Intergenic
901107206 1:6765809-6765831 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
901260651 1:7868338-7868360 CAGTTGCAGGAGGATGAGCTTGG + Intergenic
901425609 1:9180900-9180922 CAGGAGCAGAGGGAGCAGCTGGG - Intergenic
902320877 1:15664803-15664825 CTTGAGCGGAAAGATGTGCTTGG + Exonic
902571062 1:17347436-17347458 CTGGAGCAGCAGGAGGAGCACGG - Intronic
903192613 1:21665404-21665426 CTGGGGCACAGAGATGAGCTGGG - Intronic
904278391 1:29399405-29399427 CTGGAGCAAAAGGAAGAGAGAGG - Intergenic
904478455 1:30779181-30779203 CTGGAGGAGAAGGAGAAGCTGGG + Intergenic
905809311 1:40900157-40900179 CTGAGGCAGAAGGATCACCTGGG + Intergenic
906008337 1:42499572-42499594 CTGGAGCAGGAGGATGGCTTGGG - Intronic
906432534 1:45766759-45766781 CTGGTGCAGATGCATGTGCTTGG - Intergenic
906651331 1:47515209-47515231 CTGGAGCAGAGGGCTGAGCAAGG - Intergenic
906702638 1:47871236-47871258 CAGGAGCAGGAGAATGTGCTTGG + Intronic
906727740 1:48056016-48056038 TTGGAGAAGAGGGAGGAGCTGGG - Intergenic
907296891 1:53461164-53461186 CCGGAGGAGGAGGAGGAGCTCGG + Intronic
909754760 1:79210993-79211015 CTGGAGCAAAAAGATTAGATAGG + Intergenic
911144154 1:94536361-94536383 CCGAAGCAGAAGGATCAGCCTGG - Intronic
911664550 1:100538819-100538841 CTGAAGCAGAATAATGGGCTGGG - Intronic
911912134 1:103650399-103650421 CTGGAGAAAAAGGGTGAACTGGG + Intergenic
911916320 1:103701549-103701571 CTGGAGAAAAAGGGTGAACTGGG - Intronic
911919549 1:103744537-103744559 CTGGAGAAAAAGGGTGAACTGGG + Intronic
912017421 1:105059481-105059503 CTGGAGTAGAAATATGATCTGGG - Intergenic
912558814 1:110535543-110535565 CTGGGGCAAAAGGATGAGCAGGG + Intergenic
912879426 1:113394017-113394039 CCATGGCAGAAGGATGAGCTGGG + Intronic
912908761 1:113735130-113735152 CTGAAGCAGGAGGATCACCTGGG + Intronic
913057239 1:115174011-115174033 CTGTAGGAGAGGGATGGGCTTGG + Intergenic
913249545 1:116901152-116901174 CTGCAGCACAAGGATGGGCTAGG + Intergenic
913256326 1:116957303-116957325 CTGGAGGCTAAGGAAGAGCTGGG + Intronic
915252153 1:154598214-154598236 CAGGAGCAGACAGAGGAGCTGGG + Intronic
915340443 1:155174238-155174260 CTGGAGCGTGAGGAGGAGCTAGG + Intronic
916445147 1:164864952-164864974 CTAGATCAGACGGATGACCTCGG - Intronic
916476510 1:165174609-165174631 CTGGAGCAGAGGGCCGTGCTGGG + Intergenic
917495939 1:175540308-175540330 CTGGAGCTGAAGGATTCTCTGGG - Intronic
917730538 1:177870605-177870627 CGGAAGCAGAAGGATGAGAAAGG + Intergenic
918449380 1:184644327-184644349 CAGGAGCAGATGGATGTGCTCGG - Intergenic
918626363 1:186660301-186660323 CTGGAGCAGAAGGAAGAGAGAGG + Intergenic
918851170 1:189692665-189692687 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
919050947 1:192510638-192510660 CTGGAGCAGAAGGTTCATTTTGG + Intergenic
919775330 1:201190726-201190748 CTGGAGGAGAAGGAGGAGGCGGG + Intergenic
919802008 1:201359764-201359786 CAGGAGGAGAAGGAGGAGCATGG + Intronic
921115792 1:212089851-212089873 TTGGGGAAGAAGGAAGAGCTGGG - Intronic
921405315 1:214772631-214772653 CTGGAGCAGAAGGAAGAGCGAGG - Intergenic
922221569 1:223612296-223612318 AAGGAGCAGAAGGAGGACCTTGG - Intronic
922329541 1:224562273-224562295 CTGGAGTAGAAGGGTCAGCAGGG - Intronic
922932795 1:229403365-229403387 CTTGAGCAGAAGGAAGAGTGAGG + Intergenic
923164063 1:231342657-231342679 CTGAGGCAGAAGGATCACCTGGG - Intronic
924049968 1:240070777-240070799 CTGGAGCAGGAGGAAGAGAGAGG + Intronic
924291126 1:242537559-242537581 CTGGAGGAGTAGGAGGAGATAGG - Intergenic
1062768383 10:82050-82072 CTGGAGAAGAGGGGTCAGCTTGG + Intergenic
1063437130 10:6043356-6043378 CTGGAGGGGAAGAATGAGATTGG + Intronic
1064217553 10:13413093-13413115 CTGGACCAGGAGGATGTGGTGGG + Intergenic
1064242653 10:13645115-13645137 CTGCAGCAGAAGGAATACCTTGG + Exonic
1064559407 10:16581296-16581318 CTGGAGCAGAGTGAAGAGGTAGG - Intergenic
1064876510 10:20000994-20001016 CTGGAGTAGCAGGATGAGCTGGG + Intronic
1065786436 10:29220089-29220111 CTGGAGCAGGAGGAAGAGAGGGG - Intergenic
1065896405 10:30166610-30166632 CTGGAGCAGAAAGAGGACATAGG - Intergenic
1067075116 10:43174233-43174255 TTGGAGCTGATGGATGAGTTTGG - Intronic
1067079568 10:43205505-43205527 CTGGAGCCCAGGGCTGAGCTGGG - Intronic
1067157437 10:43794023-43794045 CTCCAGGAGAAGGATGAGCTGGG - Intergenic
1067466489 10:46502957-46502979 CTGGACCAGGAGCAGGAGCTGGG + Intergenic
1067620699 10:47881648-47881670 CTGGACCAGGAGCAGGAGCTGGG - Intergenic
1069323633 10:67204377-67204399 CTGGAGCAGGAGGAAGAGAGAGG - Intronic
1069536982 10:69261112-69261134 TTGGAGAAGAAGGATAAGGTTGG - Intronic
1069694678 10:70377782-70377804 CTGAAGCAGATGGGTGGGCTTGG - Intronic
1070789754 10:79181973-79181995 CTGGAGGAGGAGGAGGAGCCAGG + Intronic
1071186924 10:83057307-83057329 TTGGAGAAGAAAGATGGGCTGGG + Intergenic
1071983899 10:91031675-91031697 CTGGAGCACAGGAATGAGCATGG - Intergenic
1072261523 10:93679473-93679495 TTAGACCTGAAGGATGAGCTGGG + Intronic
1072566017 10:96617398-96617420 CTGGAGCAGAAGGTTCATGTTGG + Intronic
1073231335 10:101973309-101973331 CTGGAGCAGTGGCATGATCTCGG - Intronic
1073396830 10:103224938-103224960 CTGGAGCAAGAGGAAGAGATCGG + Intergenic
1073589559 10:104743571-104743593 CTGGACCAGATGGATAATCTTGG + Intronic
1073616772 10:105004258-105004280 TGGGAGCAGAAGGTTGACCTTGG + Intronic
1074402912 10:113156664-113156686 CTCGAGCAGATGGATCAGGTTGG + Intronic
1074423896 10:113333868-113333890 CTGGAGGAGATGGTTAAGCTAGG - Intergenic
1074509661 10:114100902-114100924 CCGGAGCAGAAGGAGGAGGCGGG + Intergenic
1074671534 10:115797442-115797464 CTGGGGCAGAAGGAAGGGCTGGG + Intronic
1075549848 10:123384050-123384072 CTGGAGCAGAGGAGTGACCTTGG + Intergenic
1075834630 10:125443183-125443205 CTGGACCAAAAGGAGGAGGTTGG - Intergenic
1076638505 10:131899064-131899086 CTGCAGCAGAAGGCACAGCTGGG - Intergenic
1076698177 10:132257038-132257060 CAGGAGCAGATGGATGGGCAGGG + Intronic
1077037399 11:502079-502101 CTGGAGCAGAGGGAGGAGCTCGG + Exonic
1077087323 11:760408-760430 CTGGAGCAGAGGGCAGATCTAGG - Intronic
1077915550 11:6609358-6609380 CTGGAGTACAAGGAAGAGCAGGG + Exonic
1078163063 11:8858556-8858578 CAGGAGCAGATGGGAGAGCTGGG + Intronic
1078355643 11:10629712-10629734 CTGCAGAAGGAGGATGAGCTGGG + Intronic
1079531753 11:21462669-21462691 CTGGAGCTGCAGGATGAACAAGG - Intronic
1081441618 11:43086954-43086976 CTGGAGCAGGAGGAAGAGAGTGG + Intergenic
1081720794 11:45286630-45286652 CTGGGGTAGAAGGGTGAGCAAGG - Intergenic
1082080764 11:48010911-48010933 CTGAAGCGGAAGGATGACTTGGG - Intronic
1082708354 11:56520884-56520906 CTGAAAGATAAGGATGAGCTTGG - Intergenic
1083068043 11:59945938-59945960 CTGGAGCAGGAGGAAGTGGTCGG + Intergenic
1083203545 11:61134035-61134057 CAGGAGCAGAAGGCAAAGCTGGG - Exonic
1084214109 11:67638485-67638507 CTGGAGCAGAGGGGGGTGCTGGG + Intronic
1084593694 11:70105002-70105024 CTGGAGGAGAGGGCTGGGCTTGG - Intronic
1084676494 11:70638417-70638439 CTGGGGCTGCAGGATGTGCTCGG + Intronic
1084736438 11:71108540-71108562 CTGGAGCAGGAGGCTGGGTTGGG - Intronic
1085015330 11:73170091-73170113 CTGGACCTGAAGGAGGGGCTAGG + Intergenic
1085452388 11:76642481-76642503 CTGCAGGAGAAGGCGGAGCTTGG - Intergenic
1085530894 11:77191427-77191449 CTGGTGCTGAAGGAAGAGCATGG + Intronic
1086269697 11:85046809-85046831 ATGGAGCAGAAGAAAGAGTTAGG - Intronic
1086453156 11:86936777-86936799 CTGTAGTAGGAGGCTGAGCTGGG + Intronic
1086457556 11:86974303-86974325 CTGGAGTAAAAGGAGGAGGTTGG - Intergenic
1087168703 11:95028649-95028671 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
1088360550 11:108984766-108984788 ATGGAGCAGAAGCATGGGCCTGG + Intergenic
1089483483 11:118826555-118826577 CTGGAGTGGAATGGTGAGCTCGG - Intergenic
1090068962 11:123527101-123527123 TGGGAGGAGGAGGATGAGCTTGG + Intronic
1090658484 11:128863272-128863294 CTGGAGCAGAGGGAGGGGCAGGG + Intronic
1091234993 11:134015661-134015683 CTGGAGCAGGAGCCTGAGGTGGG + Intergenic
1091449620 12:564356-564378 CTGGAGCAGAAGGAAGCAGTGGG + Exonic
1091660139 12:2377109-2377131 CTGGAGGAGAAGGAAGGGCTGGG + Intronic
1092087017 12:5770917-5770939 TTGGAGCAGATGGAGGAGGTAGG - Intronic
1092503101 12:9066506-9066528 GTGGAGCAGAGGGGTGTGCTAGG - Intergenic
1095852981 12:46831102-46831124 CTGGATCACAAAGAGGAGCTGGG + Intronic
1096005643 12:48168850-48168872 CTGGAGCAGCCGGAGGAGCACGG + Intronic
1098282634 12:68877075-68877097 TTGAAGAAGAAGGATTAGCTAGG - Intronic
1098571219 12:71989433-71989455 AGGAAGCAGGAGGATGAGCTGGG - Intronic
1099211223 12:79791423-79791445 CTGAGGCAGAAGGATCAGTTGGG - Intronic
1099424080 12:82501469-82501491 CTGGACCACAAGGAGAAGCTGGG - Intergenic
1100094933 12:91022599-91022621 CTGAGGCAGGAGGATCAGCTGGG - Intergenic
1100472606 12:94906921-94906943 CTGGCACAAAAGGATGGGCTGGG - Intronic
1100807214 12:98298180-98298202 CTGGTGCAAAATGATGAGCAGGG - Intergenic
1101782751 12:107850059-107850081 GTGGAGAAGAAGGAGGAGCAGGG - Intergenic
1101829530 12:108246537-108246559 CTCCCGCAGAAGGAGGAGCTGGG - Intronic
1101938744 12:109083026-109083048 CTGGAGCTGCAGGATGGGCCGGG + Exonic
1102726652 12:115071418-115071440 TTGGAGCAGAAGGAGGTGATGGG - Intergenic
1102924222 12:116814583-116814605 CTGGAGCAGAAGAAGGGGCAGGG + Intronic
1104736392 12:131138258-131138280 CTGGGGAAGGAGGATGGGCTGGG - Intronic
1104953085 12:132451194-132451216 CTGGAGCAGGGGGCTCAGCTGGG - Intergenic
1105024450 12:132838962-132838984 CTGGAGCAGTCGGAACAGCTTGG - Intronic
1105068856 12:133221669-133221691 CTGGTGCGGAAGGATGTGCCAGG + Intronic
1105523399 13:21152334-21152356 TTGGAGCTCAAGGATCAGCTGGG - Intergenic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106823036 13:33487797-33487819 CTGCAGCATAAGTATAAGCTTGG - Intergenic
1108354367 13:49617086-49617108 CTGAGGCAGGAGGCTGAGCTTGG + Intergenic
1108525093 13:51279677-51279699 CTGGACCAGGAGGATAGGCTGGG + Intronic
1109391104 13:61694857-61694879 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
1110314779 13:74093249-74093271 CTGGAGCAGAAATATAATCTTGG + Intronic
1110775329 13:79402705-79402727 CTGGGGCAAAAGGATGGGATTGG - Intronic
1111111130 13:83710999-83711021 CTGGGGCAGAAGGGTCACCTGGG + Intergenic
1111175909 13:84596085-84596107 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
1111962437 13:94826046-94826068 CTGGAACAGGAGGGTGAGTTTGG + Intergenic
1112229589 13:97575080-97575102 CTGGAGTAGAAGGCTGTGTTTGG + Intergenic
1113032501 13:106009951-106009973 CATGAGCAGGAGGGTGAGCTAGG - Intergenic
1113639917 13:111949856-111949878 ATGGGGAAGAAGGATGAGCCAGG + Intergenic
1114297841 14:21346042-21346064 CTGAGGCAGAAGGATCACCTGGG - Intronic
1115121250 14:29940713-29940735 CTGGAGCAGGAGGATGAGTTGGG - Intronic
1116039953 14:39674003-39674025 ATGGAGTAGTAGGATGAGCATGG - Intergenic
1116069505 14:40025935-40025957 TTGTGGCAGAAGGATGAGGTGGG + Intergenic
1116581134 14:46642950-46642972 CTGGAGCAGAGGGCTGAGAATGG + Intergenic
1117811214 14:59549412-59549434 CTGCAGCAGGAGGATCACCTAGG + Intronic
1118367651 14:65109376-65109398 CAGGAGCTGAAAGATGAGGTTGG - Intergenic
1121174805 14:91882998-91883020 CAGGAGCAGAAGTATGTGCCGGG + Exonic
1121448280 14:93992235-93992257 CAGGAGCAGAAGGAACAGCAGGG + Intergenic
1121607473 14:95251957-95251979 ATGGAGGAGAAGGATTAGCGAGG + Intronic
1121735298 14:96214006-96214028 CAGGAGGGGAAGGAGGAGCTGGG + Intronic
1121788151 14:96678365-96678387 CTGGAGCAGAAAGAAGAGAGAGG - Intergenic
1122651936 14:103231028-103231050 CTGGAGCAGACAGGGGAGCTGGG + Intergenic
1122818670 14:104328739-104328761 CTGGAGCAGCTGGAAAAGCTGGG - Intergenic
1123059059 14:105586211-105586233 CTGGGGGAGCAGGCTGAGCTTGG + Intergenic
1123681831 15:22769243-22769265 CTGAAGCAGAAGGAGCAGATGGG - Intergenic
1123691647 15:22843120-22843142 CTTCAGCAGAAGGCTGAGATTGG + Intronic
1124253675 15:28123754-28123776 CTGCTCCAGAAGGATGAGGTGGG - Intronic
1124344400 15:28912524-28912546 CTGGAGCATCAGGGTGAGCGCGG + Intronic
1124593787 15:31077347-31077369 CTGGAGCAGAAGGAGGTGGGAGG + Intronic
1126994226 15:54421471-54421493 CTGGACCAGCAGCATCAGCTAGG + Intronic
1127339052 15:58021908-58021930 CTGGTGCAGGCGGATGAGTTAGG + Intronic
1127524221 15:59776127-59776149 CTGGAGAAGAGAAATGAGCTGGG - Intergenic
1128680874 15:69650441-69650463 CTGGTGCAGAAGAATGAGTTAGG - Intergenic
1129109416 15:73328989-73329011 CTGGAGCTGAGAGATGAGGTGGG + Intronic
1129198065 15:73982785-73982807 CTGGAGCAGAAAGCAGGGCTGGG + Exonic
1129301053 15:74625779-74625801 CTGGAGGAGGAGGATGGGCAGGG - Intronic
1129389702 15:75214450-75214472 CTGGGGCAGCAGGCTGGGCTCGG - Intergenic
1130032993 15:80332817-80332839 ATGGAGCAGAAGCAAGATCTAGG - Intergenic
1130549111 15:84878524-84878546 CTGAAGCAGAAGGAGGTGGTTGG - Intergenic
1131002545 15:88950245-88950267 CTGGGGCGGAAGGATCACCTGGG + Intergenic
1131395255 15:92080573-92080595 CTGGAGGAGAAGGAGAAACTGGG + Intronic
1131671589 15:94625638-94625660 TTGAAGTAGAAGTATGAGCTAGG + Intergenic
1132068961 15:98758605-98758627 CTGGGACAGCAGGATGAGCAGGG + Intronic
1132472368 16:112647-112669 CTGGAGCGCCAGGATCAGCTTGG + Exonic
1132748743 16:1447661-1447683 CTTTAGGAGAACGATGAGCTGGG + Exonic
1132869006 16:2107325-2107347 CTGGGTCAGGAGGCTGAGCTGGG + Intronic
1132917047 16:2355153-2355175 CTGGAGCAGGAGGAAGAGAGTGG + Intergenic
1134039243 16:11055355-11055377 CTGGAGCATGAGGAGGAGCCAGG + Intronic
1134278855 16:12800715-12800737 CTGGAGCAGAAAGATGAGGTTGG - Intronic
1134618005 16:15666717-15666739 CTGAGGCAGAAGGATCACCTGGG - Intronic
1135074941 16:19384979-19385001 CAGGAGCAGAAGAATGAACCAGG + Intergenic
1136019340 16:27430094-27430116 CTGGAGCAGCAGCAGGAGCAAGG - Exonic
1136023113 16:27452569-27452591 TTGGGGCAGAGGGAAGAGCTTGG + Intergenic
1136412901 16:30087133-30087155 ATGGGGCAGAAAGATGAGCTAGG - Intronic
1136516117 16:30769348-30769370 CGGGAGGAGAAGGATGAGTTGGG + Exonic
1136671605 16:31863516-31863538 CAGGGGCAGAAGGAAAAGCTGGG + Intergenic
1137690430 16:50423112-50423134 CTGGACCAGAAGGATGAAATTGG - Intergenic
1138340153 16:56283878-56283900 ATGGAGCAGCAGAATGAGATGGG - Intronic
1138607189 16:58096960-58096982 CTGGAGGAAAAGGCTGAGCCGGG + Intergenic
1139031174 16:62882704-62882726 CTGGAGCAGAAGGACGAGGAAGG + Intergenic
1139077704 16:63473627-63473649 CTTGGGCAGAAGGATCAGCATGG - Intergenic
1139973518 16:70791100-70791122 CTGGAGTAGAAGCCTGTGCTGGG - Intronic
1140165938 16:72551260-72551282 CTGGAACTGTAGGTTGAGCTTGG + Intergenic
1140167138 16:72564260-72564282 CTGAAGCAGAAGGATTATTTGGG + Intergenic
1141221105 16:82070042-82070064 GTGGAGAAGAAGGATTAGGTTGG - Intronic
1142565365 17:836608-836630 CTGGAACAGATGGAAGAGCCGGG - Intronic
1142637350 17:1266318-1266340 CTTGAGCAGAAGGAAGAGGCAGG + Intergenic
1143080168 17:4375764-4375786 CTGGAGTAGAAGGAAGAGAAGGG + Intergenic
1143080420 17:4377313-4377335 CTGGAGTAGAAGGAAGAGAAGGG - Intergenic
1143282578 17:5765869-5765891 CTGGAGTACACGGAGGAGCTTGG + Intergenic
1143358666 17:6350178-6350200 CTGAGGCAGATGGATTAGCTGGG - Intergenic
1143564854 17:7715261-7715283 CTGGGGGAGAAGGATGAGTCAGG + Intergenic
1143850162 17:9804973-9804995 CTGGAAAACAAGGAAGAGCTTGG + Intronic
1144227442 17:13163390-13163412 CTGGAGCAGGAGCAAGAGATGGG + Intergenic
1146633552 17:34487765-34487787 CCAGAGCTGAAGGCTGAGCTGGG + Intergenic
1148069743 17:44901551-44901573 CTGGAGCGGAAGGATAAGATGGG + Exonic
1149374960 17:56034552-56034574 TTGGAGCAGAAGCAGCAGCTAGG + Intergenic
1150291391 17:63984437-63984459 CTGGGGCCGACAGATGAGCTGGG - Intergenic
1150707942 17:67504547-67504569 CTGGAGCAAAGGGAAGACCTGGG + Intronic
1150967184 17:69984670-69984692 CTGGATAAAAAGGATGAGTTTGG - Intergenic
1151521282 17:74632135-74632157 CTGGAGCAAAAGTGTGAGCCGGG - Intergenic
1151539917 17:74759574-74759596 CTGGAGCTGCAGCCTGAGCTGGG - Intronic
1151727643 17:75893917-75893939 CGGGTGCAGAAGACTGAGCTAGG - Intronic
1151868071 17:76818059-76818081 CTGGAGCAGGAGGAAGAGAGGGG + Intergenic
1152140046 17:78530837-78530859 CTCAGGTAGAAGGATGAGCTAGG - Intronic
1152162358 17:78676760-78676782 CTGTAGCACAAGCATGAGCTCGG - Intronic
1152324608 17:79628228-79628250 GGGGAACAGAAGGATGTGCTAGG - Intergenic
1152331693 17:79677322-79677344 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
1152961266 18:81875-81897 CTGGAGAAGAGGGGTCAGCTTGG + Intergenic
1155815815 18:30307962-30307984 CTGGAGAAAAAGGAAGAGGTGGG + Intergenic
1157406123 18:47424034-47424056 ATGGGGCAGAAGGATGGGCCTGG - Intergenic
1157991769 18:52504800-52504822 CTGGAGAAGCAGGCTGAGGTTGG - Intronic
1158803123 18:60936803-60936825 CTGGAGCAGGAGGAAGAGGCAGG + Intergenic
1159902439 18:74060222-74060244 CTGGAGAAAAAGAAAGAGCTGGG - Intergenic
1161091048 19:2360219-2360241 GTGGAGCAGAAGCCGGAGCTGGG - Intergenic
1163361988 19:16852540-16852562 CTGAAGAATGAGGATGAGCTGGG - Intronic
1163612291 19:18307873-18307895 CTGGAGGAGGAGGAGGAGGTAGG + Intronic
1164535622 19:29084712-29084734 CGGGTGCAGAAGGAGGGGCTGGG + Intergenic
1164691731 19:30215823-30215845 CTAGAGCTGAAGGGTGAGCCGGG + Intergenic
1165004767 19:32795838-32795860 CTGGAGCAGGAGCAGGAGCAGGG + Intronic
1165230193 19:34381932-34381954 CAGGAGCTGCAGGAGGAGCTGGG + Intronic
1165559444 19:36666754-36666776 CCGGTGGAGAAGGAAGAGCTGGG - Exonic
1165641682 19:37394378-37394400 CAGGATCAGAAAGATGGGCTGGG - Intergenic
1166476654 19:43131596-43131618 CTGGAGCAGCAGGCTCACCTGGG - Intronic
1167581913 19:50349836-50349858 CTGGAGAAAAAGGGTGAACTGGG + Intronic
1168266694 19:55227439-55227461 CTGGAGCACAAGGCTGAGGTAGG + Exonic
1168492436 19:56821961-56821983 TGGGAGCAGAAGGATGAGGCAGG - Intronic
925839647 2:7979588-7979610 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
925871792 2:8278164-8278186 CTGGACCAGGAGCATGTGCTGGG - Intergenic
926133542 2:10320430-10320452 CTGGAGCAGAAGGGAGAGCAGGG - Intronic
926208272 2:10849404-10849426 CTGGAGCAGGAGGAAGAGGGTGG + Intronic
926223147 2:10949229-10949251 CTGGGGCAGATGGATGGGCTGGG + Intergenic
926262744 2:11282250-11282272 CTGGGGCAGCAGGATCACCTGGG + Intronic
926410468 2:12597159-12597181 CTGGAACAGAAGCATGGGCAGGG + Intergenic
926429604 2:12772592-12772614 CTGAAACAGAAGGATAGGCTGGG + Intergenic
926776161 2:16425354-16425376 CTAGGGCAGAATGATGAGCAGGG - Intergenic
926824087 2:16884854-16884876 CTGGAGTAAAAGGATGAAGTAGG - Intergenic
927139139 2:20118033-20118055 CTGGAGGAGCAGGAGGAGCCCGG + Intergenic
927139163 2:20118117-20118139 CTGGAGGAGCAGGAGGAGCCCGG + Intergenic
927571840 2:24166972-24166994 CTGGAGCAGAGGCAGGAGCCAGG + Intronic
927786914 2:25980937-25980959 CTGGAGCAGCCGGGTCAGCTTGG + Exonic
928372067 2:30747445-30747467 CTGGAGGCCAAGGGTGAGCTGGG + Intronic
929073469 2:38057792-38057814 CTGGATCAGAAGGAAGAGGGAGG - Intronic
929253418 2:39782999-39783021 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
929536602 2:42788003-42788025 CTGGAGCTGAAGGAGGAGTTGGG - Intronic
930940799 2:57012494-57012516 CTGGAGCAGGAGGAAGAGTTGGG - Intergenic
931207648 2:60163670-60163692 CTGAAGCAGAAAGATGGTCTGGG - Intergenic
931744324 2:65278762-65278784 CAGGAGCAGAGGGAGGAGCCTGG + Intergenic
931771821 2:65503946-65503968 CTGCAACAAAATGATGAGCTTGG - Intergenic
931777793 2:65555069-65555091 CTTGAGGGGAAGGATGAGGTTGG + Intergenic
932461229 2:71883226-71883248 CTGAAACAGAAGGAACAGCTGGG + Intergenic
932598929 2:73111274-73111296 CTGGAGGAGGGGGATGAGCCTGG - Intronic
934993037 2:98934924-98934946 CTGGTGGAGAAGGTTGAGCTGGG - Intronic
936779814 2:116018525-116018547 AAGGAGCAGAATGATGAGTTGGG + Intergenic
937398494 2:121560591-121560613 GTGGAGCAGAGGGATGTTCTTGG - Intronic
937530262 2:122819459-122819481 TTGGAGCAGAAGCATGACATGGG + Intergenic
937791460 2:125967052-125967074 TTGGAGCAGAAGGAGGAGATTGG - Intergenic
937973931 2:127569821-127569843 CAGGAACTGCAGGATGAGCTTGG - Exonic
938137873 2:128774143-128774165 AAGGAGAAGATGGATGAGCTCGG + Intergenic
938343146 2:130548711-130548733 CTGGAGCAGAGTGACGAGCAGGG + Intronic
938346687 2:130572011-130572033 CTGGAGCAGAGTGACGAGCAGGG - Intronic
938416310 2:131105880-131105902 CTGGAGCAGAGGGAGCAGCAGGG - Intronic
938765101 2:134455661-134455683 CTGTGGCTGAAGGATGACCTGGG - Intergenic
939219867 2:139287931-139287953 CTGCAGCAGAAGGTGGAGCCTGG + Intergenic
940269299 2:151874001-151874023 CTGGAGCAGGAGGAAGAGACGGG - Intronic
941595391 2:167470602-167470624 CTGAAGCAGAAGGAGGGCCTGGG + Intergenic
943566003 2:189517576-189517598 CGGGAGGGGAAGGATTAGCTTGG + Intergenic
944566643 2:200998183-200998205 CTGGAGAGGAAGGATGAGGGTGG - Intronic
945013200 2:205486627-205486649 CTGGAGCAGGAGGAAGAGAGTGG + Intronic
946093199 2:217248779-217248801 CTGTAGCTGAAAGAAGAGCTAGG + Intergenic
946196410 2:218035058-218035080 CTGGGGCAGAATGGTGAGATGGG - Intronic
946200668 2:218069112-218069134 CTGGGGCAGAATGGTGAGATGGG - Intronic
946228600 2:218278034-218278056 CTACAGCAGAAGGAAGCGCTTGG + Intronic
946415527 2:219538098-219538120 CAGGAGCAGGAGAATGTGCTGGG - Exonic
946493706 2:220174572-220174594 TTGGAGGGGAAGGAAGAGCTGGG + Intergenic
947647350 2:231753161-231753183 CTGGAGGAGAAAAATGAGTTGGG - Intronic
948078993 2:235190085-235190107 CTGGAGCCGAAGGAGGAGATGGG - Intergenic
948155579 2:235778482-235778504 CTGGGGCAGGAGGAAGAGCACGG - Intronic
948396534 2:237649096-237649118 CTGGAGCTGGAGGAGGTGCTGGG + Intronic
948590008 2:239043214-239043236 CTGGAGCAGGAGCAAGAGATGGG - Intergenic
948935862 2:241164223-241164245 CTGGGGCAGAAGGGGGAGGTGGG - Intronic
948939129 2:241187529-241187551 CTGGAACAGCAAGCTGAGCTTGG + Intergenic
1168753422 20:299168-299190 CTGGGGCATAAAGATGAGCAAGG - Exonic
1168763346 20:364943-364965 CTGAAGAAGAAGGAAGAGCCTGG + Intronic
1168772068 20:421705-421727 CTGGAGCAGAGGGATGAAGGGGG + Intronic
1169518538 20:6345456-6345478 CTGGAGCAGGAGGAAGAGAGGGG + Intergenic
1169862866 20:10171159-10171181 CTGGAGCAGAGGGAACAGCCGGG + Intergenic
1170046558 20:12091468-12091490 CTGGAACAGAAGGAGCATCTTGG + Intergenic
1170284568 20:14692113-14692135 CTGGAGCAGCAGCATCACCTGGG + Intronic
1171181340 20:23093142-23093164 CAGGAGCAGGAGGAAGCGCTGGG + Intergenic
1171295493 20:24013096-24013118 CTGGGGCAGAGGCAGGAGCTAGG - Intergenic
1171415746 20:24979421-24979443 CTGAAGCAGGAGCCTGAGCTGGG + Intronic
1172310359 20:33913365-33913387 CTGGAGCACAAGCAGGGGCTGGG - Intergenic
1172325633 20:34032303-34032325 CTGGAGCTGACCTATGAGCTTGG - Intronic
1172428724 20:34873360-34873382 CTGGAGATGAAGCATGGGCTGGG - Intronic
1172618337 20:36304939-36304961 CTGGAGCAGTGGGAAGATCTTGG - Intergenic
1173396219 20:42682631-42682653 ATGGAGCTGAGGGCTGAGCTGGG + Intronic
1173620116 20:44430115-44430137 CAGCAGCAGAAGGAGGAGCAAGG - Exonic
1173620163 20:44430338-44430360 CTGAAGAAGGAGGATGAGGTTGG - Exonic
1173951456 20:46996848-46996870 CTGGAGCAGGAGGAAGAGAGGGG + Intronic
1174039312 20:47687804-47687826 CTGAAGCAGAAGGATCACTTGGG - Intronic
1175316165 20:58048196-58048218 TTGGAACACAAGGATGAGCAAGG - Intergenic
1175565787 20:59975673-59975695 CAGGAGCAGATGGTTAAGCTAGG - Intronic
1175847971 20:62068812-62068834 TTGGAGCAGAAGGATCACTTGGG + Intergenic
1175926152 20:62472558-62472580 CTGGGTCAGAAGGCTGAGCAAGG - Intronic
1177258731 21:18700665-18700687 CTGGAGCAGGAGGAAGTGCAGGG - Intergenic
1177598575 21:23280631-23280653 CTGGAGGAGAAGAATGACCCAGG - Intergenic
1178507838 21:33177221-33177243 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
1178605531 21:34033549-34033571 CTCGAGATGAAGGATTAGCTCGG + Intergenic
1179016498 21:37598182-37598204 CAGCAGCAGTGGGATGAGCTGGG + Intergenic
1179550259 21:42139336-42139358 CTGGAGCAGGAGGAAGGGGTTGG + Intronic
1179898738 21:44377971-44377993 CTGGAGGAGGAGGCTGGGCTTGG + Intronic
1179927532 21:44544811-44544833 CTGGAGCAGACTGATCAGCAGGG + Intronic
1180211827 21:46299501-46299523 TGGGAGCAGAAGGATGAGGACGG - Intergenic
1180854277 22:19036508-19036530 CTGGAGCACAAGGTTCAGCAAGG + Exonic
1181239420 22:21468466-21468488 GCGGAGCAGCAGCATGAGCTGGG + Intergenic
1181645765 22:24231269-24231291 ATGGAGGAGGAGGCTGAGCTGGG + Intronic
1181828477 22:25539349-25539371 CTGGAACAGAAGAAGGAGATTGG - Intergenic
1181932199 22:26411223-26411245 CAGGAGCAGAGAGATTAGCTAGG - Intergenic
1182263055 22:29089741-29089763 CTGGAGCAGGAGAATGAGCAGGG - Intronic
1182428689 22:30288109-30288131 CAGCAGCAGGAGGAGGAGCTAGG + Intronic
1182443063 22:30375363-30375385 CGGGAGAAGGAAGATGAGCTAGG + Intronic
1183680949 22:39328827-39328849 CTGGAGCAGTAGGACAAGCAAGG + Intergenic
1183682269 22:39339341-39339363 GTAGAGCTGAAGAATGAGCTGGG - Intergenic
1184561146 22:45263630-45263652 GTGGAGCAGAAGAAGGAGCCGGG - Intergenic
1185001655 22:48250095-48250117 CTGGGGCTGAAGGAAGCGCTGGG + Intergenic
1185315478 22:50177167-50177189 CTGCAGCAGGAAGTTGAGCTCGG - Exonic
949819728 3:8103235-8103257 CTGTAGCAGAAAGATGAACAAGG - Intergenic
950430436 3:12947820-12947842 CTGGAGAAGGGGGAAGAGCTTGG - Intronic
950655315 3:14432810-14432832 CTGGAGGAGAAAGAGGAGCTTGG - Intronic
950857605 3:16120294-16120316 CTGGAGGAGAATGAGAAGCTGGG + Intergenic
950885970 3:16363036-16363058 CTGGAGCATTAGGCTGAGGTGGG - Intronic
950897380 3:16465742-16465764 CTTGTGCAGAAGGCTGAGCAGGG + Intronic
952258375 3:31714831-31714853 CTGGAGCAGAAGGATGAGCTGGG - Intronic
953906124 3:46869075-46869097 CTGGACCAGCAGGCAGAGCTGGG - Intronic
954317633 3:49809925-49809947 CTGCAGCTGAGGGCTGAGCTGGG + Intronic
954602270 3:51878783-51878805 CTGGAGGAGAAGGATGACACGGG + Intergenic
954635118 3:52067028-52067050 CTGGAGCAAAGGGATGAGAGGGG + Intergenic
954673651 3:52303897-52303919 CTGGCCCAGCAGGATGACCTGGG + Intergenic
954875179 3:53798555-53798577 CTGAAGGTGAAGGAAGAGCTGGG - Intronic
955246961 3:57234031-57234053 CTGGAGCAGTAACATGATCTCGG - Intronic
956749877 3:72336988-72337010 CTGGAGGAGAGGGATGAGCGGGG - Intergenic
959357787 3:105354123-105354145 CTGGGGCTGAAGGAAGAACTCGG + Intergenic
961508015 3:127384223-127384245 CTGGAGCAGGAGGAGGAGGTGGG + Intergenic
961633372 3:128317789-128317811 CTGGAGCAGAAGGCTGAAGGGGG - Intronic
961755215 3:129122806-129122828 CTAGGCCAGAAGGAGGAGCTGGG + Intronic
962009046 3:131376036-131376058 CTGGAGAACAAGGATGAGGCAGG + Intergenic
962584904 3:136832307-136832329 CTAGATTAGAAGAATGAGCTGGG - Intronic
962712884 3:138102421-138102443 CTGAAGCTGAAGGCAGAGCTTGG - Intronic
962837838 3:139204529-139204551 CTGGGGCAGAAGCATGACTTAGG - Intronic
963396762 3:144744398-144744420 CTGGAGTTGAATGATGATCTAGG + Intergenic
963867565 3:150379032-150379054 CTGGAGCAGGAGCAAGAGATGGG - Intergenic
963894780 3:150673685-150673707 CTGAAGTAGAAGGATCATCTGGG - Intronic
964314783 3:155432123-155432145 CAGGAGCAGCAGGATGTGTTGGG - Intronic
964847515 3:161059839-161059861 CTGGAGCAGAAGGAAGTGGGTGG - Intronic
966066375 3:175826798-175826820 TTGGAGCAGAAGGATGAGAAAGG - Intergenic
967154502 3:186680189-186680211 CTGGAGAAGAATGAAGAGTTTGG - Intergenic
967563596 3:190946944-190946966 TTGAAGCAGAAGCCTGAGCTCGG - Intergenic
967571991 3:191040467-191040489 CTGGAGCTGAAAGATGAAATTGG - Intergenic
968762179 4:2448446-2448468 CTGAAGCAGAAGGATGTCTTAGG - Intronic
969279108 4:6157626-6157648 CTGGGGAAGATGGCTGAGCTGGG - Intronic
971091811 4:23354256-23354278 CTGGAGCAGTGGCATGATCTTGG + Intergenic
971252384 4:24984264-24984286 CTGAAGCAGAGGGGTGTGCTGGG - Intergenic
971292367 4:25355879-25355901 CTGGAGCAGAAGAAGGTACTGGG + Intronic
971896796 4:32606485-32606507 CTGGAGCAGGAGGATGGGGTGGG + Intergenic
972077614 4:35106394-35106416 CTGGAGAAAAAGGGTGAACTGGG - Intergenic
973589711 4:52428626-52428648 TTGGAGCATTAGAATGAGCTGGG + Intergenic
973997303 4:56471925-56471947 GTGGAGCATCAGGATGGGCTGGG - Intronic
974594895 4:64001934-64001956 CTGGAGGAGAAGCTTGAACTCGG + Intergenic
975423883 4:74203603-74203625 CTGGAGCAGGAAGAAGAGATGGG + Intronic
976604604 4:86970886-86970908 CTGGAGCAGAATGTTGAGGAGGG + Intronic
976969880 4:91091840-91091862 CTGGAGAAAAAGGGTGAACTGGG + Intronic
977036920 4:91965627-91965649 CAGGAGCAGAAGAATGATCATGG - Intergenic
979349084 4:119625555-119625577 CTGGTGCAGATGGACGATCTGGG + Intronic
980503117 4:133682465-133682487 CTGGAGCTGAGGCATGAGCAAGG - Intergenic
981833355 4:149027623-149027645 ATGGGGCAGAGGGAGGAGCTGGG + Intergenic
982726469 4:158911421-158911443 CTGGAGAAGATGAATCAGCTGGG - Intronic
985225163 4:187752114-187752136 ATGGCCCAGAAGGCTGAGCTTGG + Intergenic
985285521 4:188332947-188332969 CTGGAACAGGAGAAGGAGCTTGG + Intergenic
986380433 5:7180017-7180039 CTGAGGCAGAAGGATGAGTTGGG + Intergenic
986652800 5:9981037-9981059 CTGGAGCAGAAGGACTCACTAGG - Intergenic
986976874 5:13405167-13405189 GTGGGGCAGAAGGTTGTGCTGGG - Intergenic
987345687 5:16976765-16976787 CTAGAGCAGAAGGGAGAGCTTGG - Intergenic
988016629 5:25567799-25567821 CTGGAGGAGAAGCTTGAACTCGG - Intergenic
992843093 5:80715727-80715749 CTGGAGCAGGAGGAAGAGAGAGG + Intronic
995142637 5:108749627-108749649 CCGGAGGAGAAAGATGAGGTGGG - Intronic
996205147 5:120725180-120725202 CTGAAGCAGAGTGATGAACTAGG + Intergenic
996232966 5:121088501-121088523 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
996400781 5:123060045-123060067 CTGGACCAGAAGGAAGAAGTTGG + Intergenic
996674586 5:126159232-126159254 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
996911010 5:128656571-128656593 CTGGAGCAGGAGGAAGAGCAAGG + Intronic
997599571 5:135130136-135130158 GTGGTTAAGAAGGATGAGCTGGG - Intronic
997948728 5:138224916-138224938 CTGGAACAGAGGGATGGCCTGGG - Intergenic
998141530 5:139702274-139702296 CTGGAGCAGAAGGAGCAGGGAGG - Intergenic
998318367 5:141204723-141204745 CTGAGGCAGGAGGATCAGCTGGG - Intergenic
999757772 5:154677938-154677960 CTAGAGCAGAAGGAGGGGTTTGG - Intergenic
1000210395 5:159102287-159102309 CTGGAGCATAAGGTTAAGTTTGG - Intergenic
1001462550 5:171930005-171930027 CTGGAGCATAAGGATGTACTAGG - Intronic
1002103196 5:176867468-176867490 CTGCATCCGAAGGGTGAGCTGGG - Intronic
1002407983 5:179051284-179051306 CTGGAGAAAAAGGGTGAACTGGG + Intergenic
1002569836 5:180134074-180134096 CTGGAGCAGACTGATGAGGCAGG - Intronic
1002787490 6:414666-414688 CAGGAGCAGAAGGAGGAAGTGGG - Intergenic
1003642455 6:7887400-7887422 CTCGAGGAAAGGGATGAGCTTGG - Intronic
1003796607 6:9612511-9612533 GTAGACCAGAAGGATGAGTTTGG + Intronic
1003818056 6:9863759-9863781 CTGGAGCAGGAGGAAGAGAGTGG + Intronic
1004442164 6:15663725-15663747 CTGGAGAAGAGAGAAGAGCTGGG - Intergenic
1004453971 6:15774150-15774172 CTGAGGCAGGAGGATGAGCAAGG - Intergenic
1005248851 6:23920702-23920724 CTGCGGCAGAAAGATCAGCTGGG + Intergenic
1005614319 6:27558003-27558025 CCGGAGCTGAAGATTGAGCTGGG - Intergenic
1005990413 6:30898644-30898666 GAGGAGCAGAAGGAAGAGGTGGG + Intronic
1006029912 6:31170989-31171011 CTGGAGCAGAAGGATTGCTTTGG - Intronic
1006425098 6:33958806-33958828 GTGGGGCAGAAGGAAGAGCAGGG - Intergenic
1009398727 6:63230213-63230235 CAGGAGCAGCAGGGTGAGCCCGG + Intergenic
1010012426 6:71064382-71064404 GTGGAGCAGAAGCAAGAACTAGG + Intergenic
1012143204 6:95649566-95649588 GTTGAGCAGCAGGATGAGTTTGG - Intergenic
1012409658 6:98942537-98942559 CAGGAGCAGAAGGAAGAGAGTGG - Intronic
1012883973 6:104823381-104823403 CTGGAGCAGTGGCATGATCTTGG - Intronic
1013156005 6:107491142-107491164 GAGGAGCAGGAGGGTGAGCTGGG - Intronic
1013416191 6:109926784-109926806 TTGGAGCAACAGGATGAGCCTGG + Intergenic
1013650874 6:112193281-112193303 CTGGAGCAGAGGGATGGGGTGGG + Intronic
1014317304 6:119883952-119883974 CTTGAGAAGAAGGATGAGTCTGG + Intergenic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1015263712 6:131267578-131267600 CGGGAGGAGAATGATGAGCCTGG - Intronic
1015567704 6:134590662-134590684 CTGGCACACAAAGATGAGCTGGG - Intergenic
1015886156 6:137920832-137920854 CTGAAGGAGAAGGCTGAGCTAGG - Intergenic
1016252184 6:142056990-142057012 CTGAAGCAGAAGGAAAATCTTGG - Intergenic
1016707430 6:147127013-147127035 ATGGAGCAAAAGAATGACCTAGG + Intergenic
1016827826 6:148404706-148404728 CTGGGGCAGGAGGCTGGGCTTGG - Intronic
1016936137 6:149450722-149450744 CTGTACCAGGAGGATGAGCCTGG + Exonic
1017530740 6:155289901-155289923 CTGGAGCAGTAGGAAGAGAGTGG - Intronic
1018926930 6:168213017-168213039 TTGGAGCAGGAGGCTGAGATAGG + Intergenic
1018946717 6:168352400-168352422 CTGGAGCAGGAGAAAGAGGTGGG + Intergenic
1019816364 7:3204039-3204061 CTGGAGCAGGAGGAGGAGAGAGG + Intergenic
1021443471 7:20707058-20707080 CTGTAGCATAAAGATGAGCTAGG + Intronic
1022169254 7:27808018-27808040 CTGGTGCAGAAGGATGTTCCAGG + Intronic
1023412966 7:39905657-39905679 CTGAGGCAGAAGGATCACCTGGG - Intergenic
1023611392 7:41974945-41974967 CAGGACTAGAGGGATGAGCTTGG + Intronic
1023931226 7:44707808-44707830 ATGCAGCAGAGGGATGGGCTGGG + Intronic
1026084765 7:67254044-67254066 CTGGAGCTGAAGGACGATGTGGG + Intergenic
1027848516 7:83418398-83418420 GTGGAGATGAAGGAGGAGCTGGG + Exonic
1028275277 7:88848298-88848320 TGGGGGCAGAAGGAGGAGCTGGG + Intronic
1028738001 7:94239864-94239886 CCGGAGCAGGAGCCTGAGCTGGG + Intergenic
1032384664 7:131513391-131513413 CTGGAGCAGAAGGGAGTGGTGGG + Intronic
1033385926 7:140874930-140874952 CTGGAGCAGAAGCAAGAGATGGG - Intronic
1033499895 7:141937118-141937140 CTCAAGCAGAAGAATGTGCTGGG - Intronic
1034696131 7:153055608-153055630 GGGAAGCAGAAGGAGGAGCTGGG - Intergenic
1036649415 8:10632887-10632909 ATGGCGCTGAAGGATGGGCTGGG - Intronic
1037269310 8:17108693-17108715 TGGAAGCAGAAGGATGATCTGGG - Intronic
1037497639 8:19455717-19455739 CTGGAGCAGGAGGCTGAGTAGGG - Intronic
1038164075 8:25067825-25067847 TTGGAGCAGCAGCTTGAGCTGGG - Intergenic
1038413333 8:27375201-27375223 CTGGGGCAGAAGGAAGATGTGGG + Intronic
1038679678 8:29655197-29655219 TTTCAGCAGAAGAATGAGCTGGG - Intergenic
1038713136 8:29967183-29967205 CTGGAGCAGGAGGAAGAGCTGGG + Intergenic
1038873960 8:31527687-31527709 CTGGAGCAAAAGGATTAGTTGGG - Intergenic
1038972894 8:32657357-32657379 CTGGAGAAGAAGGAATAGGTGGG - Intronic
1039064873 8:33599387-33599409 CTGGAGCCGACGGATGGGATTGG - Intronic
1040520334 8:48170991-48171013 CAGCAGCAGGAGGATGTGCTGGG - Intergenic
1043128736 8:76433895-76433917 CTGGACAAGAAGGATGAAATAGG - Intergenic
1043499488 8:80838618-80838640 CTGGAGGAGGAGGAAGAGTTAGG + Intronic
1044250453 8:89999682-89999704 CTGGAGCAGGAGGAAGAGAGAGG + Intronic
1045315410 8:101039672-101039694 CTGGAGCAGAAGGCCAGGCTGGG + Intergenic
1045348967 8:101320756-101320778 TTGGAGCAGAAGGAACAGCCAGG + Intergenic
1045379257 8:101606803-101606825 CTGGAGCAGAAAGCTAGGCTTGG - Intronic
1046463529 8:114572286-114572308 CTGTAGCACAAGGATGAGAAAGG - Intergenic
1047298665 8:123593688-123593710 CTGGAGCAGGATGATGAGTGGGG + Intergenic
1047680310 8:127247885-127247907 TGGGAGCTAAAGGATGAGCTGGG + Intergenic
1048057735 8:130884553-130884575 CTGGAGCACAAGGTAGAGCTGGG - Exonic
1048117924 8:131545854-131545876 CTGGAGGAGAAGGAGGAAGTGGG + Intergenic
1048370723 8:133773932-133773954 CTGGGGCAGCAGGAAGAGCGGGG + Intergenic
1049889428 9:54837-54859 CTGGAACAGAAGGAGGAGGGCGG - Intergenic
1050254003 9:3775082-3775104 CAGCAGCAGAAGGATGACTTTGG + Intergenic
1050735102 9:8752828-8752850 CTGGATCAGCAGTTTGAGCTGGG - Intronic
1050945783 9:11515336-11515358 CTGGAGCAGAAGGAAGTGGAAGG - Intergenic
1051896152 9:21991172-21991194 TTGCAGCAGATGGAGGAGCTAGG + Intronic
1053577086 9:39364094-39364116 CAGGATCAGCAGGAGGAGCTGGG + Intergenic
1053841592 9:42192019-42192041 CAGGATCAGCAGGAGGAGCTGGG + Intergenic
1054098657 9:60922784-60922806 CAGGATCAGCAGGAGGAGCTGGG + Intergenic
1054120057 9:61198413-61198435 CAGGATCAGCAGGAGGAGCTGGG + Intergenic
1054456592 9:65434443-65434465 CTGGAGCAGAAGGGAGGGATGGG - Intergenic
1054587699 9:66984149-66984171 CAGGATCAGCAGGAGGAGCTGGG - Intergenic
1054996634 9:71398573-71398595 GTGGAGCAGAAGAGAGAGCTGGG - Intronic
1055951733 9:81735749-81735771 CTGGAGCAGAAGCAAGGGCTGGG + Intergenic
1056188835 9:84164987-84165009 CTGGAGCCGAAGGAAGAGAGAGG - Intergenic
1056530696 9:87484755-87484777 CTGAAGCAGAAGGATAACTTGGG + Intergenic
1056955950 9:91081368-91081390 CTGGATCAGAAAAATGACCTGGG + Intergenic
1057577755 9:96257011-96257033 CTGGAGCAGCAGGAAGAGAAGGG - Intronic
1057766539 9:97924692-97924714 CAGGAGCACAAAGATGAGATGGG - Intergenic
1057880523 9:98789827-98789849 CTGCATCAGAATGATGTGCTTGG + Intronic
1058182076 9:101810306-101810328 CTGGAGAAGAAGGAAGAGAGAGG - Intergenic
1058345843 9:103960813-103960835 TAGGAGCAGAAGGAAGAGCAAGG + Intergenic
1058715319 9:107717528-107717550 CTGGCTCAGAAGGATGAGTTGGG + Intergenic
1058853601 9:109037584-109037606 CTGGAGCAGGAGGAAGAGAGGGG - Intronic
1059224305 9:112657777-112657799 GTGGAAGAGAAGGAAGAGCTTGG - Intronic
1059331180 9:113536707-113536729 CTGGAGCCCAGGGATGGGCTTGG + Intronic
1060300720 9:122373165-122373187 GTGGAGCAGGAGGCTGAGGTTGG + Intronic
1061601461 9:131673000-131673022 CTGAAGCAGAAGGAAGAGCAGGG - Intronic
1061967595 9:134025104-134025126 GAGGAGCAGGAGGAGGAGCTGGG - Intergenic
1061967610 9:134025178-134025200 CTGGAGGAGGAGGAGGGGCTGGG - Intergenic
1062117565 9:134817656-134817678 CAGGGGCAGAGGGACGAGCTCGG - Intronic
1062736892 9:138142261-138142283 CTGGAGAAGAGGGGTCAGCTTGG - Intergenic
1186761742 X:12730211-12730233 ATGGGGCAGGAGGATGAGGTGGG + Intergenic
1190446074 X:50525783-50525805 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
1191035891 X:56026275-56026297 CTGGAGAAAAAGGGTGAACTGGG + Intergenic
1192093831 X:68189193-68189215 ATGGAGCAGATGGGTGAGATGGG - Intronic
1193475212 X:81955645-81955667 CTGGAGCTGAAGGAAGAGTGGGG + Intergenic
1194872240 X:99146730-99146752 CTTGAGCTGAGGCATGAGCTAGG + Intergenic
1196425277 X:115562443-115562465 CTTTTGCAGAAGGTTGAGCTTGG + Intronic
1198817675 X:140609456-140609478 CTGAAGCAGAAGGAAGAGAGTGG - Intergenic
1198970221 X:142271108-142271130 CTGGAGAAAAAGGGTGAACTGGG - Intergenic
1199049576 X:143221366-143221388 CTGGAGCAGGAGGAAGAGATGGG - Intergenic
1199333325 X:146587659-146587681 AGGGAGCAGAAGGATGACTTTGG - Intergenic
1200777812 Y:7185415-7185437 CTGGAGATGAAGGAGGAGATGGG - Intergenic
1201237730 Y:11927704-11927726 CTGAGGCAGAAGGATTACCTAGG + Intergenic
1201680387 Y:16638904-16638926 CTGGAGAAAAAGGGTGAACTGGG + Intergenic
1201931478 Y:19354273-19354295 CAGGAGCAGAAGTAAAAGCTTGG + Intergenic