ID: 952258399

View in Genome Browser
Species Human (GRCh38)
Location 3:31715058-31715080
Sequence GGGAAGTATGGGTCAGATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 213}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952258399_952258409 12 Left 952258399 3:31715058-31715080 CCTCAATCTGACCCATACTTCCC 0: 1
1: 0
2: 0
3: 20
4: 213
Right 952258409 3:31715093-31715115 ACTTCCTCTAGCCTAGTCTGAGG 0: 1
1: 0
2: 0
3: 6
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952258399 Original CRISPR GGGAAGTATGGGTCAGATTG AGG (reversed) Intronic
900083460 1:875830-875852 GGGGAGTATGGGGGAGTTTGGGG - Intergenic
901900668 1:12359038-12359060 GGGAAGTCTGGGTCAGAAGTAGG + Intronic
902565015 1:17305674-17305696 GGGGAGGATGGGTCAGGTTCTGG - Intergenic
904400156 1:30251260-30251282 GGAAAGAATGGGTCAATTTGGGG - Intergenic
904411647 1:30328531-30328553 GGGCATTGTGGGTCAGAGTGGGG - Intergenic
905762233 1:40569409-40569431 GGGAAGCAAGGGTAAGAGTGAGG + Intergenic
906532522 1:46531932-46531954 GGAACAGATGGGTCAGATTGGGG - Intergenic
912630905 1:111245949-111245971 GGGCAGTATGGGTGAGAGTCAGG + Intergenic
913541160 1:119822357-119822379 AGGAAGGATGGGTCAGGTTTAGG + Intergenic
914816447 1:151066527-151066549 GGGAAGAATGGGCTAGATTTTGG + Intronic
916751233 1:167724386-167724408 GTGAAGGATGGGTTAGAGTGGGG + Intronic
917024867 1:170631096-170631118 AGGAAGGATGGGTCAGAATTAGG + Intergenic
917229447 1:172820179-172820201 TGGAAGTGTGGGTCACATGGAGG - Intergenic
918354734 1:183696850-183696872 GGCAAGAATTGGTCAGATTCTGG - Intronic
918774180 1:188608211-188608233 TGGCAGCATGGGTCAGATTGGGG - Intergenic
919857518 1:201715842-201715864 GGAGAGTCTGGGTCAGACTGTGG + Intronic
920511060 1:206552352-206552374 GGGAGGTATGGATGATATTGGGG + Intronic
921714098 1:218400853-218400875 GGGAAGGCAGGGTGAGATTGGGG + Intronic
924111375 1:240703049-240703071 GTGACTGATGGGTCAGATTGGGG + Intergenic
1062859919 10:803234-803256 GGGAAGACTGGGTCAGGGTGGGG - Intergenic
1064363898 10:14690092-14690114 GAGAAGGATGGGTCACATGGAGG - Intronic
1064409264 10:15091313-15091335 GGGAATTAGGGATCAGACTGGGG - Intergenic
1065466536 10:26030106-26030128 GGGAAGAATGGGGCTGAGTGTGG - Intronic
1068844296 10:61654464-61654486 GGGAAAAATTGGGCAGATTGAGG - Intergenic
1069722572 10:70559249-70559271 GGGAAGAATGGTTCAGACAGAGG + Intronic
1070911427 10:80122239-80122261 GGGAAGTTTTGGTCAGATTAGGG - Intergenic
1071316282 10:84402184-84402206 TGCAGTTATGGGTCAGATTGTGG - Intronic
1073203490 10:101755138-101755160 GAGAAGTTGTGGTCAGATTGTGG + Intergenic
1074861308 10:117512349-117512371 GGTAAGTTTGGGCCAGATTGAGG + Intergenic
1075715188 10:124551543-124551565 GGGAGGTAAGGGTCAGGTGGTGG + Intronic
1076603367 10:131673711-131673733 GGGAAGTACTGGCCAGACTGAGG + Intergenic
1077310350 11:1886059-1886081 GGGAAGTATTGGTTGGATGGAGG - Intronic
1077886699 11:6392282-6392304 GGGAAGGAGGAGTCAGATTAGGG - Intronic
1079152057 11:17908771-17908793 GAGAAATATGGGACAGATTAGGG + Intronic
1079287707 11:19153934-19153956 GGTAAGAAGGGGTCAGATTCTGG - Intronic
1080593315 11:33743490-33743512 GGAAAGTATGGGGCAACTTGGGG + Intronic
1080794570 11:35551676-35551698 GGATAGTATGCGCCAGATTGTGG + Intergenic
1081455568 11:43219108-43219130 GGGACATATGTGTCAGATGGTGG - Intergenic
1083628176 11:64082557-64082579 CGGAAGTAGGGTTCAGATTCAGG + Intronic
1084194436 11:67516439-67516461 GGGAAGTGTGTGTGAGATTTGGG + Intergenic
1084462560 11:69304008-69304030 GGGAAGGATGGGTCCGACTCAGG + Intronic
1088866295 11:113851172-113851194 GACAAGCATGGGTCAGATTAGGG - Intronic
1090577928 11:128129200-128129222 GGGAAGTAAGAGTGAGATGGGGG - Intergenic
1092568807 12:9699134-9699156 GGGAAGTGTGGGTGATTTTGGGG - Intronic
1092885641 12:12922417-12922439 GGGAAGAAAGCGTCAGAGTGAGG + Intergenic
1093969978 12:25367268-25367290 GGCCAGTATGGGGCAGGTTGGGG - Intergenic
1094419617 12:30256842-30256864 GGGAAGGATGGGGCAGGATGGGG + Intergenic
1095372161 12:41481451-41481473 AGGGAGTAAGGGGCAGATTGTGG - Intronic
1097347605 12:58511495-58511517 GAAAAGTAAGAGTCAGATTGAGG - Intergenic
1101385313 12:104252176-104252198 GGGAAGTATGAGACATATTCAGG + Intronic
1101452103 12:104789133-104789155 GGGAAGTATAGGCCAGATGAAGG + Intergenic
1101540183 12:105658072-105658094 GGTAGGGATGGGTCAGTTTGAGG + Intergenic
1101677581 12:106932250-106932272 GGTAAGAATGGGTAAGAATGAGG - Intergenic
1102041660 12:109804932-109804954 GGGAAGAATGTTTCAGATTGGGG - Intronic
1102549511 12:113681422-113681444 GGGAAGAATGGGGGAGATTGAGG + Intergenic
1103341138 12:120221790-120221812 GGGAAGTGTGGGGCTGACTGTGG - Intronic
1103401366 12:120645290-120645312 GGAAAGTGAGGGTCAGCTTGTGG + Intronic
1105368835 13:19785281-19785303 GGGGAAACTGGGTCAGATTGTGG - Intergenic
1105918622 13:24940533-24940555 GTGAAGTATTGTTCAGAGTGTGG + Intergenic
1106006645 13:25776309-25776331 AGGAAGAATGGGTCAGTTTCAGG - Intronic
1107109330 13:36678971-36678993 GGGAAGAATGGGTCACAGTGAGG - Intronic
1109553347 13:63935791-63935813 AGGAAGGATGGGTCAGAGTCAGG + Intergenic
1109935992 13:69285068-69285090 TGGAATTCTGGCTCAGATTGTGG + Intergenic
1110681041 13:78312225-78312247 GGGAAGTATGGATCGGAAGGTGG - Intergenic
1111200337 13:84927892-84927914 AGGAAGGATGGGTCAGAATCAGG - Intergenic
1112951280 13:104999634-104999656 GGGAAGTAACGCTAAGATTGTGG - Intergenic
1114230879 14:20781389-20781411 GGGAGGTAGTGGTCAGATAGAGG + Intronic
1114532343 14:23403782-23403804 GGGACGAATGGGACAGAGTGAGG + Intronic
1115888469 14:38000849-38000871 GGGCAGGATGGATCAGGTTGTGG + Intronic
1116560919 14:46377339-46377361 AGGAAGGATGGGTCAGAGTTAGG + Intergenic
1117571206 14:57050828-57050850 GGGAATTATGGGAGAGATTTGGG + Intergenic
1120508844 14:85387637-85387659 GGAGAGAAGGGGTCAGATTGTGG + Intergenic
1121891890 14:97602319-97602341 GGGGAGTAGGAGTCAGATCGCGG + Intergenic
1123960382 15:25392705-25392727 GGGAAGAATGTTTCAGATAGAGG + Intronic
1125985698 15:44049290-44049312 TGGAAGTATTGGTCAGATGGTGG - Intronic
1128068625 15:64779697-64779719 GGAAAGTTGGGGTCAGAATGGGG - Intergenic
1130175444 15:81564542-81564564 GAGGAGTATGGGGCAGAGTGAGG - Intergenic
1130275550 15:82474458-82474480 GTGTAGTGTGGGTCACATTGAGG + Intergenic
1130760039 15:86809655-86809677 GGGAAGAATGTGTCAAGTTGGGG + Intronic
1130837936 15:87670118-87670140 GGGATGTTTGGGTTAGAATGTGG - Intergenic
1131122825 15:89833728-89833750 GGGCAGTGTGGGTCAGAAGGTGG - Exonic
1132466872 16:81623-81645 GGGAAGAAGGGGTCAGTGTGGGG - Intronic
1132466889 16:81680-81702 GGGAAGAAGGGGTCAGTGTGGGG - Intronic
1132466906 16:81737-81759 GGGAAGAAGGGGTCAGTGTGGGG - Intronic
1132723926 16:1330669-1330691 GGGAAGTTGGGGGCAGATTCTGG + Intergenic
1134595374 16:15491716-15491738 GGGAAGAATGCTTCAGATAGAGG - Intronic
1135791580 16:25401463-25401485 GGGTAGGATGGGTCACATTCTGG + Intergenic
1139169696 16:64615585-64615607 AGGAAGGATGGGTCAGGTTTAGG + Intergenic
1139409773 16:66750401-66750423 GGTAAGTTGGGGGCAGATTGTGG - Intronic
1139640294 16:68286794-68286816 GGGAGGTATGGGTAGGAATGAGG + Intronic
1140782171 16:78306742-78306764 GGGAATTATGGGACAGAGTGGGG - Intronic
1142037548 16:87871009-87871031 GGGAAGAATAGGGCAGATGGAGG - Intergenic
1146357441 17:32146100-32146122 GGGAAGTAAGGGCTAGATTGTGG - Intronic
1149486713 17:57047863-57047885 GGGGAGTGCAGGTCAGATTGTGG + Intergenic
1149864485 17:60143153-60143175 GGGAAATATGTGTGAGGTTGGGG - Intergenic
1150649062 17:66998163-66998185 GGGAACTCTGCTTCAGATTGGGG - Intronic
1151652766 17:75480434-75480456 GGGAGGTATGGGCCAGAGGGTGG - Intronic
1151667507 17:75553707-75553729 GGGAGGCGGGGGTCAGATTGGGG + Intronic
1152107396 17:78338727-78338749 GGGAAGACTGGGTCAGATCCTGG - Intergenic
1156445150 18:37231165-37231187 GAGCAATATGGGACAGATTGAGG - Intronic
1158315277 18:56205379-56205401 CAGAAGAATGGGTCAGATTTGGG + Intergenic
1158903277 18:61986344-61986366 GGGTAGAAAGGGTCAGAGTGAGG - Intergenic
1168202670 19:54827893-54827915 TGGAAGTAGGGGTGAGATGGGGG - Intronic
926031580 2:9595370-9595392 GGGAGTTATGTGTCAGTTTGGGG - Intronic
927443817 2:23140272-23140294 GGGAAGTAGAGGCCAGATTGGGG - Intergenic
927504614 2:23604840-23604862 AGGAAGCATGGGTCAGGATGGGG - Intronic
928406943 2:31022162-31022184 GGGAAGTGGGGGTCAGAAAGGGG + Intronic
928915238 2:36463535-36463557 GAGATGTATGGGTCAGAGGGTGG - Intronic
929640754 2:43577071-43577093 CGGAAGCATGGGTCGGAGTGGGG - Exonic
931623039 2:64230177-64230199 GGGAATTATGGGTTGGATTGGGG - Intergenic
932033758 2:68219038-68219060 GGTCAGTTTGGGACAGATTGTGG - Intronic
933602534 2:84347782-84347804 AGGAAGGATGGGTCAGAATCAGG + Intergenic
935229449 2:101083157-101083179 GGGAAGTATGGGAGAGAAGGAGG - Intronic
936712213 2:115144262-115144284 GGGAAGCATGGGTCAGAATAAGG - Intronic
936938018 2:117856969-117856991 GGGAAATGGGGGTCAGATAGTGG + Intergenic
937482440 2:122276505-122276527 TGGGAGTTTGGGTCAGCTTGGGG + Intergenic
937511414 2:122599253-122599275 GGGAAGTATGGATGATTTTGAGG + Intergenic
938078414 2:128354549-128354571 AGGAAATATGGGACAGACTGGGG - Intergenic
938268155 2:129944299-129944321 GGGAAATTTTGGTCAGATTATGG + Intergenic
941982485 2:171474382-171474404 GGGAAGGAGAGGTCAGTTTGTGG - Intronic
942311565 2:174661469-174661491 GGGAAGTGTGCGTCAGGCTGAGG - Intronic
944380282 2:199101273-199101295 GGGAAGTAGCTGTCAGTTTGAGG + Intergenic
945500919 2:210573719-210573741 GGGAGGTATGGGTCTGATTAAGG + Intronic
945851839 2:215017412-215017434 GGGAACTAAGGGTAAGTTTGTGG - Intronic
946254440 2:218432620-218432642 CTGAGGTATGGTTCAGATTGGGG + Intronic
946286788 2:218710191-218710213 GGGAAGGATGGGTTAGAGGGAGG + Intergenic
946812043 2:223536261-223536283 GGTGAGTAGGGGTCAGATTCTGG - Intergenic
948061170 2:235044266-235044288 GGGAAGTAAGCATCAGACTGTGG + Intronic
1169977352 20:11345114-11345136 AGGAAGTATGATTCATATTGGGG - Intergenic
1171517635 20:25750559-25750581 GGGAAGTATGGGTTAGAGGAGGG - Intergenic
1174778433 20:53366724-53366746 GGGAAATATGGAACAGAGTGTGG - Intronic
1174992147 20:55522767-55522789 AGGAAGGATGGGTCAGAGTCTGG + Intergenic
1175274804 20:57761069-57761091 GGGAATTGTGGGTCACATGGAGG - Intergenic
1177545557 21:22553239-22553261 GTGAGGAATGGGTCAGATTATGG + Intergenic
1177905626 21:26967926-26967948 TGGGAGTAAGGGACAGATTGTGG - Intergenic
949777112 3:7645814-7645836 GGAAAATTGGGGTCAGATTGGGG - Intronic
949928900 3:9063003-9063025 AGGAAGTATTGGTGAGAATGTGG - Intronic
950611107 3:14127237-14127259 GGGAATTTTGGTTCAGAATGTGG + Intronic
951445797 3:22779038-22779060 TGGAAGTATTGGTAAGTTTGAGG - Intergenic
952258399 3:31715058-31715080 GGGAAGTATGGGTCAGATTGAGG - Intronic
953401250 3:42620112-42620134 GGACAGTCTGGGTCAGGTTGTGG + Intronic
953975001 3:47375753-47375775 GGGAAGTATGTTTCAGAAAGGGG - Intergenic
954910334 3:54101247-54101269 GGTAAGTATGGGTCTGTTTCTGG + Intergenic
955284126 3:57622541-57622563 GGGATGTCTGGGTCATATGGTGG - Intergenic
955832119 3:63015617-63015639 AGGAAGGATGGGTCAGGGTGAGG + Intergenic
957758799 3:84527476-84527498 GGAAAGTAAGTGTCAGATTAAGG - Intergenic
960477249 3:118144875-118144897 AGGAAGGATGGGTCAGAGTTAGG + Intergenic
965044396 3:163557036-163557058 GGTAAGCATGAGTCAGATTGTGG - Intergenic
968182706 3:196609026-196609048 GGTAAGTTGGGGTCAGTTTGTGG + Intergenic
970155108 4:13133734-13133756 AGGAAGGATGGGTCAGAGTTAGG - Intergenic
970233831 4:13938643-13938665 TGGAAGTATTGTTCAGATCGCGG - Intergenic
972269522 4:37497075-37497097 GGGAAGAGTGGGACAGAATGAGG - Intronic
972831543 4:42819781-42819803 GAGAAATCTGGGACAGATTGTGG + Intergenic
973650593 4:52993868-52993890 GGGAAGTGTGGGAGATATTGGGG + Intronic
976642616 4:87354778-87354800 GGGAAATATGGGGAAGTTTGAGG + Intronic
977035957 4:91953863-91953885 GTCAAGTGTTGGTCAGATTGTGG - Intergenic
979583882 4:122391600-122391622 AGGAAGGATGGGTCAGGTTTAGG + Intronic
981224643 4:142278723-142278745 AGGAAGTATGGAGGAGATTGTGG + Intronic
981429504 4:144644153-144644175 GGGAAGAAAGGGTTAGATAGTGG + Intergenic
984112957 4:175643089-175643111 GGGAAGAATCGGTCTGATTATGG - Intronic
984199742 4:176703468-176703490 GGGAAGTGTGGGTCAGTTGTGGG + Intronic
985440730 4:189980973-189980995 GGGAAGTGTGGGGGAGGTTGGGG + Intergenic
987453869 5:18119608-18119630 AGGAAGGATGGGTCAGAGTTAGG - Intergenic
990741308 5:58915405-58915427 AGGAAATAGGGGGCAGATTGTGG + Intergenic
991728953 5:69563676-69563698 GGGAAGGATGGGAAAGAGTGAGG - Intronic
991805384 5:70418822-70418844 GGGAAGGATGGGAGAGAGTGAGG - Intergenic
991866001 5:71064200-71064222 GGGAAGGATGGGAGAGAGTGAGG + Intronic
995080674 5:108047700-108047722 AGGAAGGATGGGTCAGAATGAGG - Intronic
997869503 5:137495038-137495060 GGGAAGTTTTGGCCAGATGGAGG - Intronic
997944386 5:138186262-138186284 GGGAAGTAGGAATCATATTGTGG - Intronic
1003317477 6:5025453-5025475 GGCAAGGATGGGCCATATTGGGG + Intergenic
1003392350 6:5724786-5724808 GGAAATTATGGGGCAGATTATGG - Intronic
1003657399 6:8025376-8025398 GGGAAGTTTGTGTCAGGATGGGG - Intronic
1004242412 6:13936800-13936822 GGCAAATATGGGACAGTTTGGGG + Intronic
1007359755 6:41346453-41346475 GGAAAGCATGGGTGAGATGGCGG - Intronic
1008468253 6:51854667-51854689 AGGAAGGATGGGTCAGAGTTAGG + Intronic
1010053672 6:71538575-71538597 TGGTAGAGTGGGTCAGATTGGGG + Intergenic
1010562417 6:77367030-77367052 GGCAATTATGTGTCAGATTGGGG + Intergenic
1013581848 6:111542812-111542834 GGAAAGTAGTGGTCAGATTCTGG + Intergenic
1014582059 6:123150484-123150506 GGGAAGGATGTGTTAAATTGGGG + Intergenic
1016544592 6:145206805-145206827 GGTAATTATGGGTCAGCTGGAGG + Intergenic
1019437353 7:1028863-1028885 GGGAGAGATGGGGCAGATTGGGG - Intronic
1020982613 7:15090184-15090206 GGGAAGTAGGGGAGAGATTTAGG + Intergenic
1024680114 7:51677573-51677595 GGTAAGTGTGGGTGAGAATGTGG + Intergenic
1026469091 7:70679444-70679466 GGAAAGTTTGGGTCACATTAAGG - Intronic
1027853852 7:83483993-83484015 GGAAAGGTGGGGTCAGATTGGGG - Intronic
1028271646 7:88798130-88798152 TGGAAGTATTGATCAGAGTGGGG - Intronic
1028559569 7:92159408-92159430 TAGAAGCATTGGTCAGATTGGGG - Intronic
1029467647 7:100736458-100736480 AGGAAGAATGGGTCACAGTGAGG - Intronic
1031080913 7:117256112-117256134 GGGGAGTATGGGCTAGATTGTGG + Intergenic
1031804593 7:126292757-126292779 AGGAAGGATGGGTCAGAGTCAGG - Intergenic
1032335160 7:131018324-131018346 TGGAAGAAAGGGTTAGATTGGGG - Intergenic
1033113935 7:138608576-138608598 GGGATGTCTGGGTCAGAATCTGG + Intronic
1038416116 8:27397267-27397289 GGGAGGAATGGGTCAGAGAGAGG + Intronic
1038538858 8:28374544-28374566 GGGAAGCATGGCCCAGATTCAGG - Intronic
1040032402 8:42837532-42837554 CAGAAGTATGGGTCAGATCATGG - Exonic
1041179336 8:55231536-55231558 GGGAAGGATGGGGCAGGCTGGGG - Intronic
1044242089 8:89900341-89900363 GGGAATTAAGGGGCAGAGTGGGG + Intergenic
1044345000 8:91095102-91095124 GGGGTGTATGGGTCAGACAGAGG - Intergenic
1045943583 8:107768594-107768616 GGGAAGTAGGAATCAGATTGCGG + Intergenic
1046057409 8:109095504-109095526 AGGAAGTCTGAGCCAGATTGTGG + Intronic
1046338893 8:112826073-112826095 GGGAGGGATGGGTCAGGTTCAGG + Intronic
1047105989 8:121730832-121730854 AGAAAGCATGGGTGAGATTGAGG + Intergenic
1048882490 8:138882324-138882346 GGGAAGTGTGTGTGAGTTTGAGG - Intronic
1049217974 8:141416486-141416508 GGCAAGAATGGGTCAGCTTCAGG - Intronic
1049403277 8:142440362-142440384 GGGAGGCAGGGGTCAGATGGGGG + Intergenic
1050602132 9:7263597-7263619 GGCAAGTTTAGGTCACATTGTGG + Intergenic
1050790421 9:9461723-9461745 GGAATTTATGGGCCAGATTGAGG + Intronic
1052369243 9:27645573-27645595 GGGAAGGATGGGTCAGAGTCAGG - Intergenic
1052677769 9:31649017-31649039 GGGAACTCTGAGTCAGATTTGGG + Intergenic
1055675494 9:78655467-78655489 GGGAAGAATAGGGCAGTTTGGGG - Intergenic
1057081774 9:92178905-92178927 GGGAAGAAATGGTCAGATTTGGG + Intergenic
1057217234 9:93235867-93235889 TGGAGGGATGGGTCAGAGTGAGG - Intronic
1059465911 9:114468804-114468826 GGGCAGGATGGGTCAGATCATGG - Intronic
1059954414 9:119500741-119500763 GGGAAGTATGGGCTAGAAGGAGG - Intronic
1062741700 9:138178914-138178936 GGGGAGTATGGGGGAGGTTGGGG - Intergenic
1186332266 X:8547303-8547325 GTCAAGTATTGGTGAGATTGAGG - Intronic
1186607760 X:11109806-11109828 GGGAATTATGGGAGAGACTGGGG + Intergenic
1186778358 X:12888563-12888585 CAGAAGTATGGGTGAGCTTGCGG - Exonic
1190213506 X:48466196-48466218 GGGAGGTGGGGGTCAGCTTGGGG - Intronic
1190529614 X:51361688-51361710 AGGAAGGATGGGTCAGATTCAGG - Intergenic
1192612439 X:72580877-72580899 GGGAAGGATGGGACAGAAAGGGG + Exonic
1193039310 X:76987745-76987767 AGGAAGGATGAGTCAGATTTAGG - Intergenic
1193987956 X:88269948-88269970 GGGGTGTAAGGGCCAGATTGAGG - Intergenic
1194176922 X:90661974-90661996 GGGAAGTATGGGTTCAAGTGGGG + Intergenic
1194794904 X:98199460-98199482 GGGAATTATGGGTTTGATTTAGG - Intergenic
1194920385 X:99758315-99758337 GGGAAGAATGGGGAAGAATGTGG + Intergenic
1196756383 X:119160937-119160959 GGGAAGTATGGATCAGGCTTTGG + Intergenic
1199279930 X:145989619-145989641 GGGAAGCATTGGTGAGAGTGTGG - Intergenic
1200804045 Y:7413795-7413817 GTGAAGTTTGGGTAATATTGTGG + Intergenic
1202368276 Y:24181277-24181299 GTGTAGTGTGGGTCACATTGAGG - Intergenic
1202372421 Y:24207905-24207927 GTGTAGTGTGGGTCACATTGAGG + Intergenic
1202498364 Y:25462215-25462237 GTGTAGTGTGGGTCACATTGAGG - Intergenic
1202502509 Y:25488840-25488862 GTGTAGTGTGGGTCACATTGAGG + Intergenic