ID: 952258770

View in Genome Browser
Species Human (GRCh38)
Location 3:31718816-31718838
Sequence AGACCCGGGATGGGGACGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 223}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952258762_952258770 11 Left 952258762 3:31718782-31718804 CCTGCATAAAACTGCATTAAAAA 0: 1
1: 0
2: 1
3: 32
4: 445
Right 952258770 3:31718816-31718838 AGACCCGGGATGGGGACGGAAGG 0: 1
1: 0
2: 2
3: 26
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952258770 Original CRISPR AGACCCGGGATGGGGACGGA AGG Intronic
900096947 1:943679-943701 AGACCTGGAAGGGGGAGGGAGGG - Exonic
900236970 1:1597616-1597638 AGAGCTGGGGTGGGGACGGTGGG - Intergenic
900488100 1:2933075-2933097 AGCCCCAGGCTGGGGATGGAAGG + Intergenic
900612495 1:3550076-3550098 ATTCCCGGGATGGGGAGGGCTGG - Intronic
901036430 1:6338810-6338832 ATACCCAGGCTGGGGACGGGAGG - Intronic
901655172 1:10765123-10765145 AGACGCGGGATTGGGAAGCAGGG + Intronic
902581523 1:17410688-17410710 AGGCCTGGGCTGGGGAGGGAGGG - Intronic
903028581 1:20446803-20446825 AGAGCTGGGATGGGGGCGGGGGG + Intergenic
904423955 1:30411442-30411464 AGACCCGAGATGGTGAGGGCGGG - Intergenic
905010632 1:34744870-34744892 AGACGTGGGATGGGGAAGAAAGG - Intronic
905847078 1:41242135-41242157 AGACGCGGGAAGGGGGCGGGCGG + Intronic
906004280 1:42455825-42455847 AGACCCGGGAAAGGGAGAGAGGG + Intronic
908501006 1:64744584-64744606 ACACCCGAGATGGGGCTGGAGGG - Intergenic
911117811 1:94264740-94264762 AGACCGGGGATGGGGTGAGATGG - Intronic
913200362 1:116491103-116491125 ACACCCTGGATGGGGCTGGAAGG - Intergenic
913460898 1:119085157-119085179 AGACCAGGGATAAGGACAGAGGG - Intronic
913593825 1:120354599-120354621 AGACCAGGGACGGGGATGGGAGG + Intergenic
913680589 1:121185188-121185210 AAACCCGGGCTGGGGCGGGAAGG + Intronic
914001726 1:143699994-143700016 AGACCAGGGGTGGGGAAGGGAGG - Intergenic
914032420 1:143972830-143972852 AAACCCGGGCTGGGGCGGGAAGG + Intergenic
914093430 1:144524387-144524409 AGACCAGGGACGGGGATGGGAGG - Intergenic
914157025 1:145095137-145095159 AAACCCGGGCTGGGGCGGGAAGG - Intronic
914305099 1:146409515-146409537 AGACCAGGGATGGGGATGGGAGG + Intergenic
914596960 1:149163310-149163332 AGACCAGGGACGGGGATGGGAGG - Intergenic
914881894 1:151553531-151553553 AGCCCCGGGATGGGGAGGGGAGG + Intronic
915594476 1:156888296-156888318 AGACCCAGGAGGGTGAGGGAGGG + Intergenic
916802237 1:168226187-168226209 AGGCCCGGGCAGGGGACGCAGGG - Intronic
917638385 1:176958836-176958858 AGCCATGGGATGGGGACGGTGGG - Intronic
920375973 1:205508203-205508225 AGTCCAGGGAAGGGGACGTAAGG - Intronic
921358204 1:214306225-214306247 AGACCGGGGATGGGGCTGGAGGG - Intronic
921933756 1:220777341-220777363 AGGCCCGGGAGGGGGTTGGAGGG + Intronic
922176660 1:223202645-223202667 AGAGCAGGGATGGGGAGGGGAGG + Intergenic
922661780 1:227436302-227436324 AGACTCGGGATGTGGAGGGCTGG + Intergenic
922895482 1:229096899-229096921 AGAAAAGGGATGGGGAAGGAAGG + Intergenic
924282888 1:242455909-242455931 AGAGCCGGGGTGGGGACAGAAGG + Intronic
924551621 1:245083297-245083319 AGACCAGGGGAGGGGAGGGATGG - Intronic
1063444175 10:6098420-6098442 AGTCCCGGGCAGGGGAGGGAGGG + Intronic
1063600869 10:7480242-7480264 GGACCCGGGATGGGAAAGGGTGG + Intergenic
1064484019 10:15766525-15766547 AAACCCAGGATGCGGAAGGAGGG + Intergenic
1065077684 10:22097695-22097717 AGACCAAGGATGGGGAGGGAGGG - Intergenic
1065203025 10:23331565-23331587 GGAACCGGGATGGGGAAGGGAGG + Intronic
1065588401 10:27241569-27241591 AGACTGGGCATGGGGACGGCCGG + Intronic
1067385078 10:45811558-45811580 AGAGACTGGATGGGGACAGATGG - Intergenic
1070139715 10:73730250-73730272 AGAGCCCGGACGGGGAGGGAAGG - Intergenic
1070886621 10:79905238-79905260 AGAGCCGGGACGGGGAGGGAAGG + Intergenic
1071328182 10:84536965-84536987 AGAAACTGGATGGGGAGGGAGGG - Intergenic
1072196721 10:93122307-93122329 AGAGCAGGGCCGGGGACGGAGGG + Intergenic
1072563656 10:96599488-96599510 AGAACCGGGATGGAGTGGGATGG + Intronic
1074123183 10:110508405-110508427 ACACACAGGATGGGGAGGGAGGG - Intronic
1075571623 10:123550658-123550680 AGACCCGGGTTGGAGCGGGATGG - Intergenic
1076707248 10:132308480-132308502 AGGCCCGGGATGCGGGCGGCGGG + Intronic
1077194711 11:1273605-1273627 AGACCGGCGATGGGGACGCCCGG + Intergenic
1078086100 11:8233752-8233774 AGAGCCAGGCTGGGGAAGGAGGG - Intronic
1079114959 11:17634954-17634976 AGGCCCGGGGTGGGGAGGGTGGG + Intronic
1082948789 11:58788710-58788732 ACCCCTGGGTTGGGGACGGAAGG + Intergenic
1083257504 11:61505743-61505765 AGACCTGGGAGGGGGAAGCAGGG - Intergenic
1083324550 11:61866686-61866708 AGCCCCGAGATGGGGAGGGCTGG - Exonic
1084204493 11:67583953-67583975 AGACCCGGGACGGGGGCCTAGGG + Intronic
1084766122 11:71309722-71309744 AGACCTGGGATTGGGAGGGATGG + Intergenic
1085707369 11:78798777-78798799 AGACCCTGAAAGGGGACTGAAGG - Intronic
1086944955 11:92835918-92835940 AGCCAAGGGATGGGGAAGGATGG - Intronic
1087789373 11:102391072-102391094 AGAGCCGGGATGGGGACCACTGG - Intergenic
1088257632 11:107916071-107916093 AGACCCAGGATGGGCATGGTGGG - Intronic
1088599137 11:111460157-111460179 AAACCAGAGATGGGGAAGGAAGG - Intergenic
1089395984 11:118136536-118136558 AGACCTGGGGTGGGGGCTGATGG - Exonic
1090977214 11:131688292-131688314 AAACCCAGGAGGGGCACGGAAGG - Intronic
1090982785 11:131738115-131738137 AGCCAGGGGATGGGGATGGATGG + Intronic
1091929045 12:4379825-4379847 AGACCCCGGAGGCGCACGGAAGG + Intergenic
1092283082 12:7112171-7112193 AAACCAGGGATGGGGCCAGAGGG - Intergenic
1096149210 12:49298021-49298043 AGACCCGGAATGGGGAGGTGAGG + Exonic
1096626384 12:52898613-52898635 GGACCTGGGGTGGGGACGGTGGG - Intronic
1101717010 12:107320139-107320161 AGACGCGGGAGGGGGACGCGAGG - Intronic
1102197446 12:111034979-111035001 AGACTTGGGAAGGGGATGGAAGG - Intronic
1103087274 12:118071290-118071312 AGGTGCGGGATGGGGAAGGATGG - Intronic
1103557365 12:121774806-121774828 GGCCCCAGCATGGGGACGGATGG - Intronic
1103800170 12:123533034-123533056 AGACCCGACGTGGGGAGGGAGGG - Intronic
1103905972 12:124327360-124327382 ACACCGGGGGTGGGGACAGACGG + Intronic
1107407137 13:40125560-40125582 AGACCTGGGGTGGGGCCTGAAGG - Intergenic
1113565592 13:111317855-111317877 AGGCCCGGGGAGGGGACGGACGG - Intronic
1113967764 13:114164154-114164176 ATACCCGGCAGGGGGACCGAGGG + Intergenic
1114842338 14:26279901-26279923 AGAACTGCGATGGGGACAGAAGG - Intergenic
1115530215 14:34320144-34320166 AGACTTGGGATGGGGACAGTTGG - Intronic
1115566540 14:34629847-34629869 GGACCCAGGATGGGGAAGGAGGG + Intronic
1115754423 14:36518315-36518337 TGACCCGGGCTGGGCACGAAAGG - Intronic
1116515558 14:45800720-45800742 AGACAAGGGATGGGGGCTGAGGG + Intergenic
1119859698 14:77927206-77927228 AGCCGAGAGATGGGGACGGATGG - Intronic
1120143608 14:80955573-80955595 AGACCCGGGAGCGGGAGGGGTGG - Exonic
1120541942 14:85761577-85761599 AGAGCTGGGATGGGAACAGAAGG + Intergenic
1120835806 14:89037483-89037505 AGACAGGGGATGGGGCAGGATGG + Intergenic
1122177407 14:99931248-99931270 AGATCTGGGGTGGGGAGGGAGGG - Intronic
1122299666 14:100724598-100724620 AGAACCTGGATGGGGAAGGGAGG + Intergenic
1122385381 14:101341795-101341817 AGACACGGGATGAGGCTGGAAGG - Intergenic
1128124982 15:65185436-65185458 AGGCCCGGGGAGGGGGCGGAGGG + Intergenic
1128392419 15:67191091-67191113 AGACTTGGGATGGGGAGGGAGGG + Exonic
1128582698 15:68820216-68820238 AGGCGCGGGAGGGGGGCGGAAGG + Intronic
1129107869 15:73321671-73321693 AGACCAGAGATGGGGAGAGAGGG + Exonic
1129825817 15:78634466-78634488 AGCCCCAGGATGGGGAGGGCTGG - Intronic
1130776962 15:86994345-86994367 CGTCCCAGGATGGGGTCGGATGG + Intronic
1132373751 15:101314906-101314928 AGACCAGTGATGGGGAGGGGCGG - Intronic
1133008788 16:2898757-2898779 GGACCTGGGGTGGGGATGGAAGG - Intronic
1133040424 16:3057532-3057554 CGATCAGGGATGGGGAAGGATGG - Exonic
1134739148 16:16527068-16527090 AGCCCAGGGATGAGGAGGGAAGG + Intergenic
1134928353 16:18185083-18185105 AGCCCAGGGATGAGGAGGGAAGG - Intergenic
1135632436 16:24046686-24046708 AGCCTCGGGATGGGGAGGGGTGG + Intronic
1136278153 16:29191697-29191719 AGACTCGGGATGGGGGCTGAGGG - Intergenic
1140457074 16:75111813-75111835 AGACCCTGGAGGGGGAGGGGAGG + Intergenic
1141553429 16:84821172-84821194 AGACCCTGGATGGGGAAAGCAGG - Intronic
1141677795 16:85526614-85526636 AGAGCAGGGATGGGGAGGGGTGG + Intergenic
1141822866 16:86459641-86459663 AGCCCAGGGGTGAGGACGGAGGG - Intergenic
1142028575 16:87827272-87827294 AGCCCCGGGACGGGGGCGGATGG + Intergenic
1142069480 16:88083266-88083288 AGATCTGAGATGGGGAAGGAAGG + Intronic
1142082530 16:88157737-88157759 AGACTCGGGATGGGGGCTGAGGG - Intergenic
1142133293 16:88440780-88440802 AGACCAGGGATGGGGGCCGGCGG - Intergenic
1142302326 16:89265904-89265926 AGACCAGGGTGGGGGCCGGAAGG + Intergenic
1142904361 17:3032595-3032617 AGACCTGCAATGGGGAAGGAGGG + Intronic
1143155415 17:4833438-4833460 AGACCGGGGAGGGGGAGGGCCGG - Exonic
1143483063 17:7238330-7238352 AAGCCCCGGATGGGGGCGGAGGG - Intronic
1144642126 17:16943481-16943503 AGACCTGGGAGGGGGACAGAAGG - Intronic
1147305469 17:39561141-39561163 AGACCTGGAATGGGGAAGGGAGG + Intronic
1147386965 17:40088686-40088708 AGAGCAGGGATGGGGAGGCAAGG - Intronic
1147919178 17:43906050-43906072 AGGCCTGGGAGGGGGAGGGAAGG - Intronic
1148747721 17:49927790-49927812 GGAGCCAGGGTGGGGACGGAGGG - Intergenic
1151242864 17:72771872-72771894 AGACTTGGGGTGGGGAAGGAAGG + Intronic
1151448082 17:74180444-74180466 AGACCTGGGCTGGGGCAGGATGG + Intergenic
1152271248 17:79326168-79326190 AGGCCGGGGATGGGGGTGGATGG + Intronic
1155193761 18:23453648-23453670 GGTGCCGGGATGGGGATGGAGGG + Intronic
1155270096 18:24132594-24132616 GGACCCTGGGTGGGGAGGGACGG - Exonic
1156458261 18:37306825-37306847 AGAGCCGTGTTGGGGACAGAGGG - Intronic
1157764432 18:50286157-50286179 AGCCCCGGGATGAGGGTGGAGGG - Exonic
1158319641 18:56248874-56248896 AGACCTGGGGTGGGGGTGGAGGG + Intergenic
1160592299 18:79951417-79951439 AGGCCCAGGATGGGGGCGCACGG + Intronic
1160735746 19:661676-661698 AGACCCAGGAAGGGGCTGGAGGG - Intronic
1160777117 19:861460-861482 GGAACCGGGATGGGGATGCAGGG - Intronic
1160989209 19:1853769-1853791 AGACCTGGGATGGGGAGGGAGGG - Exonic
1161146791 19:2683729-2683751 AGACCCTGGAGGAGGAGGGAGGG + Intronic
1163000217 19:14362485-14362507 AGACCGGGGAAGGAGAAGGAAGG + Intergenic
1163337100 19:16680270-16680292 AGACCAGAGATGGGCATGGAGGG - Intronic
1163635139 19:18434020-18434042 GGTCCCGGGGTGGGGGCGGATGG - Intronic
1163838865 19:19593432-19593454 AGTCACGGGATGAGGACAGATGG + Intronic
1164760536 19:30725286-30725308 TGACCAGGGATGGGTACAGAAGG - Intergenic
1165826597 19:38709287-38709309 AGACCCGGGAGGGCGAGGGTTGG - Intronic
1166376951 19:42333051-42333073 AGACTCTGGATGGGGACAGAGGG + Intronic
1166843413 19:45712421-45712443 AGTCCCGGGCAGGGGGCGGAGGG + Exonic
1166856005 19:45782876-45782898 AGGCCTGGGAAGGGGACGGGAGG + Intronic
1168243596 19:55099044-55099066 AGCTCCGGGACGGGGACGGCTGG - Exonic
927871410 2:26626789-26626811 AGACCTGGGATGGGGCAGGTGGG - Intronic
927886340 2:26721058-26721080 ACATCCAGGATGGGGACGGGAGG - Intronic
929944529 2:46360620-46360642 AGAGCCTGGATGTGGAAGGATGG - Exonic
930268347 2:49226557-49226579 AGACCTGGGGTGGGGCTGGAAGG + Intergenic
933024262 2:77234891-77234913 AGACACTGGATGGGGAGGGAGGG - Intronic
935419266 2:102850407-102850429 AGAGCCGAAATGGGGAGGGAGGG - Intergenic
936285094 2:111175604-111175626 AGACCTGGGATGTGGACAGAGGG + Intergenic
938573767 2:132585454-132585476 AGAAGCGGGGAGGGGACGGAAGG - Intronic
939410022 2:141813291-141813313 AGAACAGAGATGGGGACTGACGG + Intronic
942045177 2:172095706-172095728 AGATCCTGGGTGGGGAGGGAAGG + Intergenic
946090557 2:217219012-217219034 AGACAAGGGCTGGGGAGGGAAGG + Intergenic
946326311 2:218986232-218986254 GGACAGGGGATGGGGAAGGATGG - Intergenic
948514899 2:238497811-238497833 AGACCCAGGATGGGGCCGCATGG + Intergenic
948703887 2:239777688-239777710 AGACCCTGGATGGGGCGGGGGGG - Intronic
948942655 2:241203955-241203977 TGACCCAGGATGGGGAAGGGAGG - Intronic
1172644639 20:36461887-36461909 GGACCCGAGATGGGGAGCGAGGG - Intronic
1173579043 20:44133060-44133082 GGAGCAGGGATGGGGACGGTGGG - Intronic
1173993222 20:47318801-47318823 AGAGCCGGGATAGGGAGGGCTGG + Intronic
1175888574 20:62305966-62305988 ACACCCGGGATTGCGGCGGATGG + Intronic
1175892158 20:62320700-62320722 TGGCCCGGGTTGGGGAGGGAAGG + Intronic
1176108406 20:63400088-63400110 GGACCGGGTGTGGGGACGGATGG - Intergenic
1178383983 21:32134707-32134729 AGAGAGGGGATGGGGAGGGAAGG - Intergenic
1179555931 21:42176116-42176138 AGACCCGGGAGTGGAACAGAAGG - Intergenic
1179616612 21:42587259-42587281 AGACGCGGGAAGGGAAGGGAAGG + Intergenic
1180200856 21:46223290-46223312 AGGACCAGGCTGGGGACGGAAGG - Intronic
1181405452 22:22681337-22681359 GGACCTGGAATGGGGATGGAGGG + Intergenic
1181733885 22:24867075-24867097 AGACGCTGGAAGCGGACGGAGGG - Exonic
1182752877 22:32655847-32655869 TGACCAGGGATGGGGAGGGATGG - Intronic
1183194518 22:36344282-36344304 GGCCCTGGGATGGGGGCGGATGG - Intronic
1185307731 22:50130638-50130660 AGACCCAGGAATGGGAAGGAAGG + Intronic
949192340 3:1265437-1265459 AGAACCAGGATGGAGAAGGAGGG - Intronic
950449459 3:13057572-13057594 AGACCAGGGCTGGGGACAGTGGG - Intronic
950631955 3:14287724-14287746 AGAGCCGGGTGGTGGACGGAGGG + Intergenic
951664249 3:25104384-25104406 AGGCCGGGGATGGGGGTGGAGGG + Intergenic
952258770 3:31718816-31718838 AGACCCGGGATGGGGACGGAAGG + Intronic
953919901 3:46944594-46944616 AGACTAGGGATTGGGAAGGAGGG - Intronic
954898420 3:53997110-53997132 AGCCCCGGGAAGGGGAGGGAAGG - Intergenic
955785666 3:62536078-62536100 AGATCTGGGATGGGGAGGGAAGG + Intronic
956411763 3:68986656-68986678 AGACTGGGGATGTGGATGGATGG - Intronic
957959288 3:87227956-87227978 AGTCTCGGAATGGGGAGGGAGGG + Intronic
959592033 3:108091467-108091489 AGACGCGGGCTGGGGCGGGACGG - Intergenic
960315012 3:116165883-116165905 ATACCCTGGATGGGGTGGGAAGG - Intronic
961812409 3:129529498-129529520 AGACCCAGGCTGGGCACTGAGGG + Intronic
962306757 3:134294297-134294319 AGACCAGGGAGGTAGACGGAAGG + Intergenic
968594855 4:1477069-1477091 AGCCCCTGGAGGGGCACGGATGG - Intergenic
969258257 4:6017636-6017658 AGCCCTGGGTTGGGGATGGAAGG + Intergenic
970191648 4:13523882-13523904 AACCCCGCGATGGGGAAGGACGG - Intergenic
970458198 4:16246429-16246451 AGACCCGAGATGGGCAGGAAGGG - Intergenic
971250462 4:24969718-24969740 CGACCAGGTATGGGGACGAATGG + Intronic
973774777 4:54233076-54233098 AGACCCGAGAGGGGGCCGGGCGG - Intronic
975762389 4:77632490-77632512 TGACCAGGTATGGGGACGAATGG - Intergenic
982278561 4:153661215-153661237 AGACCGGGGAGGAGGACGAATGG - Intergenic
983094026 4:163540934-163540956 AGCCCAGGGAGGGGGACTGAGGG + Intronic
985047565 4:185955846-185955868 AGACCTGGGGTGGGGGTGGAGGG - Intronic
985944023 5:3162832-3162854 AGGCCCGGGATGGGGAATGTGGG - Intergenic
991987030 5:72299330-72299352 AGACCTGGGATGGGGAGGGGCGG + Intronic
992579010 5:78151904-78151926 AGAGGAGGGATGGGGACGGGAGG - Intronic
993284543 5:85975019-85975041 GGACACGGGCTGGGGAGGGAGGG - Intergenic
998791037 5:145766435-145766457 AGCCCAGGGATGGGGACGGAGGG + Intronic
1001436343 5:171702563-171702585 TGCCCCGGGGTGGGGAAGGAAGG + Intergenic
1002426285 5:179178184-179178206 AGACCCGGCTTGGGGAAGGCCGG + Intronic
1002450980 5:179318390-179318412 AGACAGGGGATGGGGAGAGAAGG + Intronic
1002692748 5:181061795-181061817 AGCACCAGGATGGGAACGGATGG + Intergenic
1003275601 6:4647868-4647890 AGACCCCGGATGGGCAGGAAGGG + Intergenic
1005348020 6:24909492-24909514 ATACCCGGGTAGGGGAGGGAAGG + Intronic
1005596498 6:27383265-27383287 AGACAGGGGGTGGGGAAGGAAGG + Intronic
1007990210 6:46247194-46247216 AGGCCTGGGATGGGGCCTGAGGG + Intronic
1008621741 6:53277817-53277839 AGACCTGGGGTGGAGAGGGAAGG + Intronic
1014752786 6:125272491-125272513 CGACCAGGTATGGGGACGAACGG + Intronic
1018801098 6:167222714-167222736 ACATCCGGGCTGGGGAGGGATGG - Intergenic
1018809035 6:167284457-167284479 ACATCCGGGCTGGGGAGGGATGG + Intronic
1018900839 6:168050994-168051016 AGCCCCGGGATGGGGTGGGGGGG + Intergenic
1019321671 7:418880-418902 AGACTGGGGGTGGGGAGGGAAGG - Intergenic
1020082152 7:5291870-5291892 AGACCAGGGCTGGGGTGGGATGG - Intronic
1023860453 7:44215043-44215065 AGACCTGGGTTGGGGTGGGATGG + Intergenic
1026787101 7:73308635-73308657 GAACCCGGGGTGGGGTCGGACGG - Intronic
1026846165 7:73700237-73700259 CGACACGGGGCGGGGACGGAGGG + Exonic
1029349593 7:100003813-100003835 AGACTCGGGGTGGAGATGGATGG - Intergenic
1032950610 7:136906796-136906818 AAACCGGGGTTGGGGATGGATGG + Intronic
1033760763 7:144434423-144434445 AGACCAGGGATGGTGACAGTGGG + Intergenic
1036782286 8:11658115-11658137 AGACCAGGGCTGGGGAGGGAGGG - Intergenic
1037779239 8:21856307-21856329 TGACCTGGGATGGGGACGAGGGG + Intergenic
1041830460 8:62147572-62147594 AGACCAGGGAGGGGGAGAGAAGG + Intergenic
1045526213 8:102943141-102943163 AGACATGGGATGGGGAGGGGAGG + Intronic
1045654931 8:104376951-104376973 AGACCGGGGGTTGGGAGGGATGG + Intronic
1049473573 8:142786910-142786932 AGACACAGGATGGTGATGGATGG - Intergenic
1053143937 9:35699325-35699347 TGACCAGGGACAGGGACGGATGG - Intronic
1053418889 9:37964339-37964361 AAACCTGGGATGGGGACGGCGGG + Intronic
1055647867 9:78377807-78377829 AGACTGGGGGTGGGGAAGGAAGG + Intergenic
1058870176 9:109194485-109194507 AGACCAGGGATGGGGATTGGGGG + Intronic
1059725918 9:117008059-117008081 GGAGCCGGGATGGGGATAGAAGG - Intronic
1060189368 9:121582348-121582370 AGACTCAGCATGGGGACAGAAGG - Intronic
1060814256 9:126626486-126626508 AGAGCGGGGAAGGGGACCGATGG + Intronic
1060985755 9:127818129-127818151 AGACCCGGTCTTGGGACGCAGGG + Exonic
1061133631 9:128721551-128721573 GGACCCGGCATGGGGAGGGAAGG - Intronic
1061220247 9:129246447-129246469 ACCCCCGGGATGGGAATGGATGG + Intergenic
1061853527 9:133429360-133429382 AGGGGCGGGATGGGGATGGACGG - Intronic
1061865485 9:133489969-133489991 AGAGCGGGCATGGGGACAGATGG + Intergenic
1062391615 9:136336156-136336178 AGATCCGGGATAGGGGCGGGCGG + Intronic
1062505009 9:136868963-136868985 CGACCCCGGAGTGGGACGGACGG - Intronic
1062549458 9:137079224-137079246 AGACCAGGGATGGGTTCCGAGGG - Intronic
1062595778 9:137298535-137298557 AGACCCTGGGTGGGGAAGGGTGG + Intergenic
1188245261 X:27830565-27830587 AGGCCCCAGATGGGGGCGGAAGG + Intergenic
1190325868 X:49206593-49206615 AGACACTGGATGGTGAAGGAGGG + Exonic
1192334766 X:70209046-70209068 AGTCCCAGGATTGGGACAGAGGG + Intergenic
1196886572 X:120251350-120251372 TGCCCCGGGAAGGGGACGGAAGG - Intronic
1197600029 X:128517888-128517910 AGACCCGGGGTGGGGTTGGTTGG - Intergenic