ID: 952267833

View in Genome Browser
Species Human (GRCh38)
Location 3:31803279-31803301
Sequence GAGGCTAAGGTCTTCTAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 80}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952267818_952267833 20 Left 952267818 3:31803236-31803258 CCCCCCTTCTCCCCAGAGAGGCG 0: 1
1: 1
2: 2
3: 26
4: 298
Right 952267833 3:31803279-31803301 GAGGCTAAGGTCTTCTAGGGAGG 0: 1
1: 0
2: 0
3: 5
4: 80
952267824_952267833 10 Left 952267824 3:31803246-31803268 CCCCAGAGAGGCGCTGGCCTGAG 0: 1
1: 0
2: 5
3: 27
4: 270
Right 952267833 3:31803279-31803301 GAGGCTAAGGTCTTCTAGGGAGG 0: 1
1: 0
2: 0
3: 5
4: 80
952267827_952267833 8 Left 952267827 3:31803248-31803270 CCAGAGAGGCGCTGGCCTGAGGT 0: 1
1: 0
2: 2
3: 25
4: 247
Right 952267833 3:31803279-31803301 GAGGCTAAGGTCTTCTAGGGAGG 0: 1
1: 0
2: 0
3: 5
4: 80
952267821_952267833 17 Left 952267821 3:31803239-31803261 CCCTTCTCCCCAGAGAGGCGCTG 0: 1
1: 0
2: 0
3: 38
4: 225
Right 952267833 3:31803279-31803301 GAGGCTAAGGTCTTCTAGGGAGG 0: 1
1: 0
2: 0
3: 5
4: 80
952267819_952267833 19 Left 952267819 3:31803237-31803259 CCCCCTTCTCCCCAGAGAGGCGC 0: 1
1: 0
2: 0
3: 21
4: 307
Right 952267833 3:31803279-31803301 GAGGCTAAGGTCTTCTAGGGAGG 0: 1
1: 0
2: 0
3: 5
4: 80
952267820_952267833 18 Left 952267820 3:31803238-31803260 CCCCTTCTCCCCAGAGAGGCGCT 0: 1
1: 0
2: 1
3: 16
4: 195
Right 952267833 3:31803279-31803301 GAGGCTAAGGTCTTCTAGGGAGG 0: 1
1: 0
2: 0
3: 5
4: 80
952267822_952267833 16 Left 952267822 3:31803240-31803262 CCTTCTCCCCAGAGAGGCGCTGG 0: 1
1: 0
2: 1
3: 28
4: 274
Right 952267833 3:31803279-31803301 GAGGCTAAGGTCTTCTAGGGAGG 0: 1
1: 0
2: 0
3: 5
4: 80
952267825_952267833 9 Left 952267825 3:31803247-31803269 CCCAGAGAGGCGCTGGCCTGAGG 0: 1
1: 0
2: 5
3: 74
4: 328
Right 952267833 3:31803279-31803301 GAGGCTAAGGTCTTCTAGGGAGG 0: 1
1: 0
2: 0
3: 5
4: 80
952267829_952267833 -7 Left 952267829 3:31803263-31803285 CCTGAGGTCAGCTGAAGAGGCTA 0: 1
1: 0
2: 0
3: 10
4: 148
Right 952267833 3:31803279-31803301 GAGGCTAAGGTCTTCTAGGGAGG 0: 1
1: 0
2: 0
3: 5
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952267833 Original CRISPR GAGGCTAAGGTCTTCTAGGG AGG Intronic
901153472 1:7120294-7120316 GAGGCTACGGTCTCATAGGAAGG + Intronic
912431894 1:109632391-109632413 GAGACCAGGGTCTTCTGGGGGGG + Intergenic
912735136 1:112143706-112143728 GGGGCTGAGGTTTTCTAAGGCGG + Intergenic
917647187 1:177040636-177040658 GAGGCTATGTTCTTCTCAGGAGG + Intronic
923076480 1:230613454-230613476 GAGACTATGGTGCTCTAGGGTGG - Intergenic
923311194 1:232737187-232737209 GAGGCTAGGGTCATGGAGGGAGG - Intergenic
1063572094 10:7225025-7225047 GAAGCAAAGATCTTCTAGGTGGG + Intronic
1063904786 10:10770399-10770421 TAGGCTGAGGTCTGCTGGGGTGG + Intergenic
1066210311 10:33230671-33230693 GAGGGTTTGGGCTTCTAGGGCGG - Intronic
1071376560 10:85011397-85011419 GGGGCAAATGACTTCTAGGGTGG + Intergenic
1075697797 10:124448958-124448980 GAGGCTCAGGTCATCGGGGGAGG - Intronic
1081224623 11:40504989-40505011 CAGGCTCAAGTCTTCTAGTGGGG + Intronic
1081838335 11:46176268-46176290 GAGGCTAAGGTCAACTATGGGGG - Intergenic
1083452304 11:62754080-62754102 GGGGCTAAGGACTACCAGGGTGG + Exonic
1083953872 11:65971691-65971713 GAGGATTGGGTTTTCTAGGGAGG + Intronic
1090489077 11:127142004-127142026 GAGGCTGAGCTCTTCTCAGGCGG - Intergenic
1093538924 12:20257083-20257105 GAGTATAAGGTCCTGTAGGGTGG + Intergenic
1093838029 12:23860128-23860150 GACACTGAGGTCTTCTTGGGGGG + Intronic
1104481718 12:129113607-129113629 GGTGCTAAAGTGTTCTAGGGTGG + Intronic
1107404437 13:40099345-40099367 GAGGCCAATGTCTTCTGGTGAGG - Intergenic
1107455943 13:40554595-40554617 AAGGCAAAGGTCTTCCAGTGTGG + Intergenic
1117003958 14:51399375-51399397 GTGGCTAATGTCTACTAGAGAGG - Intergenic
1122596343 14:102895588-102895610 GAGCTTAGGGTCTTCTGGGGTGG + Intronic
1125875264 15:43138326-43138348 TAGGCTAAGCACTTCTAGGTGGG + Intronic
1128193172 15:65724163-65724185 GAGGCTGAGGCCTGCTTGGGAGG - Intronic
1128721843 15:69955912-69955934 GAGGGTCAGGTCTTCTAGCCAGG - Intergenic
1129331140 15:74827966-74827988 GGGGTTGAGGTCTTCGAGGGAGG - Intronic
1130871171 15:87973500-87973522 TAGGCTGAGGTTTTCTTGGGAGG + Intronic
1132084823 15:98899573-98899595 GAGGCGAAGGTTTTTTAGGAAGG - Exonic
1159904533 18:74077872-74077894 GTGGCTAAGGTCGTGCAGGGTGG - Intronic
1160243257 18:77137615-77137637 CAGGCCAAGGTCTTCTGGGAAGG - Intergenic
1165901905 19:39173187-39173209 GAGGCCCAAGTCTTCCAGGGAGG + Exonic
1167666130 19:50823617-50823639 GAGGGGAAGGTCTTATCGGGGGG + Intronic
1168276017 19:55279289-55279311 AAGACTAGGGTCTTCTTGGGTGG - Intronic
926648397 2:15315030-15315052 GAGGCTAAGACTTTCTAGGGTGG + Intronic
927069258 2:19508849-19508871 GAGGATAAACTCTTCTACGGAGG - Intergenic
937056407 2:118940921-118940943 GAGGCAAAGGCCCTCCAGGGAGG - Intergenic
940108820 2:150128029-150128051 GAGGCCATGGTGGTCTAGGGGGG - Intergenic
942774441 2:179564448-179564470 TAGGGTAAGGTCTTATAGAGAGG - Intronic
943123502 2:183767654-183767676 GAGACTAAGGTCTTTGAGGCAGG - Intergenic
943564503 2:189501409-189501431 GAGGCTAAGATCTTTGAGGATGG + Intergenic
943847222 2:192666986-192667008 GAGGCTAAGGTCATCCATAGAGG - Intergenic
945823414 2:214691861-214691883 GATGCTAAGGTCGTCCAGTGGGG + Intergenic
948152406 2:235754819-235754841 GAAGTTAAGGTCCACTAGGGAGG + Intronic
1176418289 21:6492847-6492869 GAGGCTTATCCCTTCTAGGGAGG - Intergenic
1179693782 21:43101169-43101191 GAGGCTTATCCCTTCTAGGGAGG - Intronic
1179809081 21:43858935-43858957 GAGGCTGAGGTCTTCTTTGCGGG + Intergenic
1185156704 22:49197381-49197403 GAGGCTGAGGGTTTCTGGGGGGG - Intergenic
950840516 3:15964098-15964120 GAGGCTAAAGGGCTCTAGGGGGG + Intergenic
951816624 3:26761968-26761990 GAGGCTCAGGTCTTTTATGGTGG + Intergenic
952267833 3:31803279-31803301 GAGGCTAAGGTCTTCTAGGGAGG + Intronic
952982856 3:38752308-38752330 GAGGAAGAGGGCTTCTAGGGAGG + Exonic
956475579 3:69616797-69616819 CAGGATCAGCTCTTCTAGGGAGG - Intergenic
960642174 3:119836170-119836192 GTGGCTAAAGTCTTCAAAGGAGG + Intronic
962547665 3:136453910-136453932 GAAGCTGAGGTTTTCTGGGGGGG + Intronic
965444932 3:168763536-168763558 GGTGCTAAGGTCTACTGGGGTGG + Intergenic
968027178 3:195452222-195452244 AAGTCCAAGGTCTTCTCGGGGGG + Intergenic
979307954 4:119169704-119169726 GAGTATAGGGTCTTCCAGGGAGG + Intronic
981599441 4:146469102-146469124 GAGGCTAATGGCTTCTAGGAGGG + Intronic
983087107 4:163460479-163460501 GTGGGTAAGGTGTACTAGGGTGG - Intergenic
991403376 5:66277478-66277500 CAGGCTAAGGTCTGCTTGAGAGG + Intergenic
992230476 5:74658527-74658549 GAGGCTAAGATCAGCTAGGTGGG + Intronic
997378315 5:133415008-133415030 GATGCTAAGGGCTTCTAAGTTGG - Intronic
1000517443 5:162256629-162256651 GCAGCAAAGCTCTTCTAGGGTGG - Intergenic
1000644382 5:163743110-163743132 GAGGCTAAGAGCTCCTAGGTTGG + Intergenic
1001841293 5:174878933-174878955 GAGTCCCAAGTCTTCTAGGGTGG - Intergenic
1006192344 6:32217295-32217317 GAGGCCAAGGTCATCGAGGGAGG + Intronic
1011928065 6:92672872-92672894 AAGGCTAAAGTCTCCTATGGGGG - Intergenic
1014197430 6:118576207-118576229 CAGGCTAAGGTCTTTTTGAGGGG - Intronic
1018920748 6:168170868-168170890 GAGGCTCTTGTCTTCTCGGGTGG + Intergenic
1023660786 7:42469091-42469113 GTGGCTAAGGTGTTGCAGGGAGG + Intergenic
1023865913 7:44238401-44238423 GAGGCTAGTGGCTTCTGGGGAGG - Intronic
1025247312 7:57327085-57327107 CAGGAGAAGGGCTTCTAGGGAGG - Intergenic
1028880527 7:95874923-95874945 GAGGCTCAGGTCTTCTAACCAGG - Intronic
1030342884 7:108400788-108400810 TGGGGTCAGGTCTTCTAGGGAGG + Intronic
1033666692 7:143447316-143447338 AAGTTTAAGATCTTCTAGGGTGG - Intergenic
1034483222 7:151339691-151339713 GAGTCTGAGATCTGCTAGGGTGG - Intergenic
1050188132 9:2996701-2996723 GAGCCTAAAGTCTTCTAAGAAGG - Intergenic
1056772907 9:89492601-89492623 GAGACTGAGGTCTTCAGGGGAGG - Intronic
1062043274 9:134413862-134413884 GAGTCTCAGGTCTTCCTGGGAGG + Intronic
1188908029 X:35811577-35811599 GTGCCTAAGGTCTTCTAGAAAGG + Intergenic
1192830419 X:74745281-74745303 GAGGCTTAGAACTTCTAGAGTGG - Intronic
1193771434 X:85592745-85592767 GAGGTTAAGGTATTTTTGGGTGG - Intergenic
1195144464 X:101999628-101999650 AAGGCTAAAGTCTCCTAGAGGGG - Intergenic
1196757772 X:119172805-119172827 GATACTAAGGTTTTCTAGTGGGG + Intergenic
1200090934 X:153635657-153635679 GATGCTCAGGCCTTTTAGGGAGG + Intergenic