ID: 952269313

View in Genome Browser
Species Human (GRCh38)
Location 3:31816759-31816781
Sequence GCTCAGAGGAGACCCGTAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 575
Summary {0: 1, 1: 1, 2: 35, 3: 198, 4: 340}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952269313 Original CRISPR GCTCAGAGGAGACCCGTAGC GGG Intronic
901403513 1:9031215-9031237 GCTCAGAGGAGGCCCACAGTAGG + Intergenic
903101820 1:21036277-21036299 GCTCAGAGGAGACCTGCAGTGGG - Intronic
903930972 1:26862373-26862395 GCTCAGAGGGGACCCTGAGGGGG + Intergenic
904365694 1:30009808-30009830 GCTCAGAGAAGACCCACAGTGGG + Intergenic
904443832 1:30551475-30551497 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
905546150 1:38801901-38801923 GCTCAGAGGAGACCCTCAGTGGG - Intergenic
906448203 1:45921984-45922006 GCTTAGAGGGGACCCGCAGTGGG + Intronic
906472910 1:46146014-46146036 GCTCAGAGAAGAGCCAAAGCCGG + Intronic
907252971 1:53155319-53155341 GTTCAGAGGAGACCCTCAGCGGG - Intergenic
907761872 1:57368662-57368684 GCTCAGAGGAGACCTGCAGTGGG - Intronic
908259273 1:62327148-62327170 GCTCAGAGGAGACCCACAGTGGG + Intergenic
910602090 1:89043205-89043227 GCTCAGAGGAAACCCACAGTGGG + Intergenic
910654903 1:89609655-89609677 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
911004100 1:93199732-93199754 GCTCAGAGGAGACCCACAGTGGG + Intronic
911050923 1:93670487-93670509 GCTCAGAGGATGCCCACAGCTGG + Intronic
911266992 1:95754138-95754160 ACTCAAAGGAGACCAGCAGCGGG - Intergenic
915200253 1:154221457-154221479 GATCAGAGGAGGCCCGCAGTGGG - Intronic
915561788 1:156692178-156692200 GCCAAGAGGAGACCCGGGGCTGG + Intergenic
918757341 1:188355502-188355524 GCAAAGAGGAGACCCATAGTGGG + Intergenic
918963167 1:191306414-191306436 GCTCAGAGGAGAGCCGCACTGGG + Intergenic
918983630 1:191595814-191595836 GCTCAGAGGAGACCCGCAGTGGG + Intergenic
919083203 1:192891136-192891158 GCTCAGAGGAGACCCACGGTGGG + Intergenic
919253950 1:195097009-195097031 GCTCTCAGGAGACCCATAGAGGG - Intergenic
919513390 1:198493863-198493885 GCTCAGAGGAGACCCACAGTGGG + Intergenic
922785551 1:228280761-228280783 GCTCCGAGGAGACCCGGGCCCGG + Exonic
922861361 1:228819083-228819105 GCTCAGAGGAGATCCTCAGTGGG - Intergenic
924404643 1:243730283-243730305 GCAGAGAGGAGACCCAAAGCGGG - Intronic
1062771387 10:104433-104455 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1064798106 10:19036744-19036766 GCTCAGGGGAGACACTTAGATGG - Intergenic
1065407923 10:25389492-25389514 GCTCAGAGGAGATCTGCAGTGGG - Intronic
1066101501 10:32122287-32122309 GCTCAGAGGAGACCCGCAGGGGG + Intergenic
1067047558 10:42993022-42993044 GCCCAGAGGAGCCCATTAGCTGG - Intergenic
1067258667 10:44667038-44667060 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
1068157645 10:53222434-53222456 GCTCAGAGGGGACCTGCAGTGGG + Intergenic
1068283615 10:54908678-54908700 GCTCAGAGGAGACCCGCAGTGGG + Intronic
1068290972 10:55001197-55001219 GCTCTCAGGAGACCCGAAGTGGG - Intronic
1068474472 10:57507481-57507503 GCTCTTAGGAGACCCGAAGTGGG - Intergenic
1069753714 10:70760913-70760935 GCTCAGAGGACACACATAGCAGG + Exonic
1070201141 10:74207507-74207529 GCTCTCAGGAGACCCGAAGTGGG + Intronic
1071060845 10:81570041-81570063 GCTCAGAGGGGACCCACAGTGGG + Intergenic
1071166751 10:82816335-82816357 GCTCTCAGGAGACCCGAAGTGGG + Intronic
1072154680 10:92714277-92714299 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1072470150 10:95706392-95706414 GCTCAGAGGAGACCCTCAGTGGG + Intergenic
1073631788 10:105156746-105156768 GCTCAGAAGAGGCCTGTAGATGG - Intronic
1074247901 10:111713392-111713414 GCTCAGGGGAGACCCACAGTGGG + Intergenic
1076791260 10:132777939-132777961 GCTCAGAGGTGACCCAATGCTGG - Intronic
1077713106 11:4555185-4555207 GGTCAGAGGAGACACTAAGCGGG + Intergenic
1077844661 11:6012243-6012265 GCTCAGAGAAGACCTGAAGTGGG + Intergenic
1078042714 11:7883616-7883638 GCTCAGAGGAGACCCACAGAGGG + Intergenic
1078345509 11:10544530-10544552 GCTGAGAGGAGACCCACAGTGGG + Intergenic
1078836364 11:15034637-15034659 GCTCAGAGGAGACCTACAGTGGG + Intronic
1079503911 11:21132957-21132979 GCTCTCAGGAGACCCGAAGTAGG + Intronic
1079710657 11:23679556-23679578 GCTCAGGGAAGACCCGCAGTGGG + Intergenic
1080583919 11:33665255-33665277 GCTCAGAGGAGACCCACAGTGGG + Intronic
1080851949 11:36077992-36078014 GCTCAGAGGAGACTCACAGTGGG + Intronic
1081283970 11:41245836-41245858 CCTTAGAGGAGACCCATAGTGGG + Intronic
1084261901 11:67984292-67984314 GCTCTTAGGAGACCCATCGCAGG - Intergenic
1084469443 11:69348492-69348514 GCTCAGAGGAGACCCGCAGTGGG + Intronic
1084981594 11:72831837-72831859 GCTCAGAGAAGCCCTGCAGCTGG + Intronic
1086249385 11:84795494-84795516 GCTCAGAGGAGACCTGCAGTGGG - Intronic
1087211012 11:95446598-95446620 GCTCAGAGGAGACCCACATTGGG + Intergenic
1087338874 11:96877947-96877969 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1087453402 11:98353245-98353267 GCTGAGAGGAGACCCACAGTGGG + Intergenic
1087534375 11:99425060-99425082 ACATAGAGGAGACCTGTAGCAGG + Intronic
1088135707 11:106553011-106553033 GCTCAGAGGAGACCTGCAGGGGG - Intergenic
1088513347 11:110600021-110600043 GCTCAGAGGAGACCCACAGGGGG - Intronic
1088651183 11:111959020-111959042 GCTCAGAGGAGACGTGCAGTGGG - Intronic
1088704218 11:112447480-112447502 GCTCAGAGGAGACCCGCAGTGGG + Intergenic
1089822450 11:121241008-121241030 GCTCAGAAGAGACCCGCAGTGGG + Intergenic
1090124842 11:124075150-124075172 GCTCAGAGGGGACCTGCAGTGGG + Intergenic
1090136970 11:124209313-124209335 GCTCAGAGGAGACCTGCAATGGG + Intergenic
1090910096 11:131111187-131111209 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
1092271995 12:7030883-7030905 GCTCTCAGGAGACCTGTAGTGGG + Intronic
1092508163 12:9125227-9125249 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1093059542 12:14588850-14588872 GCTCAGAGGAGAGCCGCAGTGGG + Intergenic
1094427359 12:30328755-30328777 GCTCGGAGGATACCTGTAGTGGG - Intergenic
1095042373 12:37456367-37456389 GCTCAGAGGAGACCCATGGTGGG - Intergenic
1095603257 12:44038006-44038028 GCTAAGAGGAGACCCTCAGTGGG - Intronic
1096171951 12:49478920-49478942 GCTCAGCGGAGACCCGCAGTGGG + Intronic
1096295610 12:50381388-50381410 GCTCAGAGGAGACCCTCAGTGGG + Intronic
1096944651 12:55391713-55391735 GCTCAGAGGAGACCAGCAGCAGG + Intergenic
1097076206 12:56396791-56396813 GCTCAGAAGAGACCCACAGTGGG + Intergenic
1097078126 12:56410263-56410285 GTTCAGAGGAGACCCACAGTGGG + Intergenic
1097129905 12:56804360-56804382 GCTCAGAGGAAACCTGCAGGGGG + Intergenic
1097446451 12:59678373-59678395 GCTCAGAGGAGACCTGCAGTAGG + Intronic
1098290825 12:68955731-68955753 GCTGAGAGGAGACCCAGAGCAGG + Intronic
1098671398 12:73235121-73235143 GCACAGAGGAGACCCGTGGTGGG + Intergenic
1098802949 12:74985249-74985271 GCTCAGAGGAGACTTGAAGTGGG + Intergenic
1098951642 12:76645666-76645688 GCTCGGAGGAGACCCAAAGTGGG - Intergenic
1099295451 12:80823068-80823090 GCTCAGAAGAGACCCACAGTGGG - Intronic
1099640793 12:85280697-85280719 GCTCAGAGGCAACCCGGTGCTGG - Intronic
1100672764 12:96834909-96834931 GCTCACAGGAGACCTGCAGCAGG + Intronic
1101086306 12:101239786-101239808 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1101763938 12:107681872-107681894 GCTCAGAGAAGACCCACAGTGGG + Intergenic
1101816858 12:108152107-108152129 GCTCAGAGGAAACCCGAGGAAGG + Intronic
1102727087 12:115075182-115075204 GCTCAGAGAAGCCCCTCAGCTGG - Intergenic
1104761216 12:131298633-131298655 GCTCAGAGGAGCCCCAGAGCTGG - Intergenic
1104818559 12:131662159-131662181 GCTCAGAGGAGCCCCAGAGCTGG + Intergenic
1105041924 12:132967455-132967477 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1106308980 13:28535994-28536016 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1106587577 13:31070588-31070610 GCTCAGAGCAGACTTCTAGCAGG - Intergenic
1108016968 13:46086380-46086402 GCTCAGAGGAGACTCGCGGTGGG + Intronic
1108240279 13:48457160-48457182 GCTTAGAGAAGACCCATAGTGGG + Intronic
1108787410 13:53921497-53921519 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1109396453 13:61765976-61765998 GCTCAGAGGAGACCTGCATTGGG + Intergenic
1109438944 13:62343789-62343811 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1109470694 13:62799888-62799910 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1109603614 13:64663411-64663433 GCAGAGAGGAGACCTGTAGAGGG - Intergenic
1109686695 13:65830124-65830146 GCTCTCAGGAGACCCGCAGTGGG - Intergenic
1109719767 13:66260602-66260624 GCAGAGAGGAGATCCGCAGCCGG - Intergenic
1109837497 13:67878097-67878119 GCTCAGAGAAGACCTGCAGTGGG - Intergenic
1110201182 13:72851843-72851865 GCTGAGAGGAGACCCACAGTTGG - Intronic
1110201188 13:72851913-72851935 GCTGAGAGGAGACCCACAGTGGG - Intronic
1110621265 13:77598600-77598622 ACTCAGTGGAGACCCTCAGCTGG - Intronic
1110778024 13:79432686-79432708 GCTCAGAGGAGACCTTCAGTGGG - Intergenic
1110939495 13:81331105-81331127 GTTCAGAGGAGACCTGTAGTGGG - Intergenic
1111202785 13:84961722-84961744 GCTCTCAGGAGACCCGTAGTGGG + Intergenic
1111347333 13:86975139-86975161 GAGCAGAGGAGACCCCTAGTGGG - Intergenic
1111485726 13:88896072-88896094 GCTGAGAGGAGACCCATAGTGGG - Intergenic
1111549075 13:89783925-89783947 GCAGAGAGGAGACCTGTAACGGG + Intergenic
1111595433 13:90404474-90404496 GCTCTCAGGAGACCCGAAGTGGG - Intergenic
1111800421 13:92974459-92974481 GCTCAGAGGAGACCCACAGTAGG + Intergenic
1113205938 13:107916025-107916047 GCTCACAGGACACTCTTAGCAGG - Intergenic
1113339214 13:109405199-109405221 GCTCAGAGGAGACTTGCAGTGGG - Intergenic
1113970744 13:114186342-114186364 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1114349524 14:21835278-21835300 GCTCAGAGGAGACCTGCATTGGG + Intergenic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1115700906 14:35952062-35952084 GCTCTGAGGAGACGCGTTGGTGG + Intergenic
1116221645 14:42095756-42095778 GCTCAGAGGAGACCTGCAATGGG + Intergenic
1116257275 14:42571777-42571799 CCTCAGAGGAGACCCAGAGTGGG - Intergenic
1116448520 14:45039182-45039204 GCAGAGAGGAGACCCTTAGAGGG + Intronic
1117285443 14:54282334-54282356 GCTCAGAGGAGACCCGCAGTGGG + Intergenic
1117734061 14:58751557-58751579 GCTCAGAGGAGACCTGCATTGGG - Intergenic
1118213491 14:63787576-63787598 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
1118410042 14:65469608-65469630 GCTCAGAGGAGAGCTGCAGAGGG + Intronic
1118473068 14:66093372-66093394 GCTCACAGGAGACCCGCAGTGGG + Intergenic
1118521976 14:66596042-66596064 GCAGAGAGGAGACCCATAGTGGG + Intronic
1118946968 14:70397915-70397937 GCTCAGAGGGGACCTGCAGGGGG + Intronic
1119439458 14:74618499-74618521 ACTCAGAGCGGACCCCTAGCTGG - Intergenic
1120405780 14:84091735-84091757 GCTCAGACGAGACCCACAGTGGG - Intergenic
1121077160 14:91078481-91078503 ACTCAAAGGAGACCCGCTGCAGG - Intronic
1122832342 14:104405334-104405356 GCTCAGAGGAGAATCGCATCGGG - Intergenic
1202840237 14_GL000009v2_random:114595-114617 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1202909618 14_GL000194v1_random:104792-104814 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1202883668 14_KI270722v1_random:84510-84532 GCTCAGAGGGGACCTGCAGTGGG + Intergenic
1202940900 14_KI270725v1_random:144092-144114 GCTCAGAGGAGACCCATAGTGGG - Intergenic
1124820916 15:33044801-33044823 GCTCAGAGGAGACCTACAGTGGG - Intronic
1125241596 15:37582652-37582674 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1125718209 15:41831724-41831746 GCTCAGAGGAGACCCACAGTGGG - Intronic
1125752417 15:42037468-42037490 GCTCAGAGGAGACCCGCAGTAGG - Intronic
1126292563 15:47099151-47099173 GCTCCGAGGAGACCCATAGTGGG + Intergenic
1127525860 15:59791689-59791711 GCTCAGAGGAGACCCGCAGTGGG + Intergenic
1127718547 15:61675861-61675883 GCTCAGAGGATCTCCTTAGCAGG - Intergenic
1128965342 15:72052335-72052357 GCTCAGAGGAGACTCGCAGTGGG - Intronic
1129368990 15:75076268-75076290 GCTCAAAGGAGACCCACAGTGGG + Intronic
1129785155 15:78304856-78304878 GCTCAGAGAAGACCCGCAGTGGG - Intergenic
1130022390 15:80242321-80242343 GCTCACAGGAGCCCCCTTGCGGG - Intergenic
1130856073 15:87841158-87841180 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1132699536 16:1216442-1216464 GCTCACAAGAGAGCCGTGGCAGG + Intronic
1132795218 16:1717488-1717510 GCTCAAAGGTGACCCATAGGTGG + Intronic
1135057035 16:19240328-19240350 GCTCAGAGGGGACCCGTAACAGG + Intronic
1136355778 16:29744327-29744349 GCTCCAAGGTGACCCGTGGCTGG + Exonic
1137256464 16:46778893-46778915 GCTCAGAGGAGACCTGCAGGGGG - Intronic
1137343940 16:47637116-47637138 GCTGAGAGGAGACCCGCAGTGGG - Intronic
1137588658 16:49680018-49680040 GCTCAGAGGAGACCCACAGTGGG - Intronic
1137623339 16:49891568-49891590 GCTCAGAGGAGACTGGCAGTGGG + Intergenic
1137825225 16:51489220-51489242 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
1138033480 16:53579765-53579787 GCCCAGAGGAGACCTGCAGTGGG + Intergenic
1139088663 16:63617990-63618012 GCAAAGAGGAGACCCACAGCGGG + Intergenic
1139349937 16:66328592-66328614 GGAGAGAGGAGACCCGTGGCAGG + Intergenic
1139463601 16:67142067-67142089 GTTCAGAGGAGACCCATGGTGGG + Intronic
1139490547 16:67283749-67283771 GCTCAGAGGAGAGGTCTAGCTGG + Intronic
1139625775 16:68187512-68187534 GCTCAGAGAAGACCCACAGAGGG + Intronic
1139700941 16:68707639-68707661 GCTGAAAGGAGACCCCTAGGAGG + Intronic
1140419506 16:74807067-74807089 GCTCAGAAGAGACCGGAAGTGGG + Intergenic
1141034449 16:80615549-80615571 GCTTACAGGAGACCCACAGCAGG - Intronic
1141424129 16:83934528-83934550 GCCCAGAGAAGCCCCGCAGCGGG - Intronic
1141606116 16:85154295-85154317 TCTCAGAGGAGACCCCAAGTGGG + Intergenic
1142116117 16:88357040-88357062 GCTGGGAGGGGACCCGTAACCGG - Intergenic
1142623071 17:1177292-1177314 GCTTAGTGGAGAGCTGTAGCAGG - Intronic
1146086976 17:29838745-29838767 GCTCAGAGGAGACCCACAGTGGG - Intronic
1146093547 17:29906041-29906063 GCTCAGAGGAGACCCGCAGTGGG - Intronic
1146143206 17:30387939-30387961 GCTCAGAGGAGACCGGCAGTGGG + Intronic
1147635392 17:41960836-41960858 GCTCATAGCAGGCCCGTGGCTGG - Intronic
1149085546 17:52710753-52710775 GCTCAGAGGAAACCCACAGTGGG - Intergenic
1149482871 17:57017743-57017765 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
1149884721 17:60328452-60328474 GCTTAGAGGAGACCTGCAGTGGG - Intronic
1150281336 17:63931175-63931197 GCTCAGAGGAGATCCTAAGGAGG + Intronic
1150521096 17:65866819-65866841 GCTCAGAGGAGACCCAGAGTGGG - Intronic
1150952862 17:69822173-69822195 GCTCAGTGGAGACCTGCAGTGGG - Intergenic
1151009997 17:70483579-70483601 GCCCAGAGGAGACCTGTAGTGGG + Intergenic
1151395245 17:73819040-73819062 GCTCAGAGGAGACCCGCAGTGGG + Intergenic
1151773147 17:76177973-76177995 GCTCAGAGGATACCCGCAGTGGG - Intronic
1152530515 17:80915976-80915998 GCTCAGAGGAGACCCACAGTTGG - Intronic
1152856570 17:82668091-82668113 GCTCAGGGGAGACCCACAGTGGG + Intronic
1152864162 17:82712374-82712396 GCTCAGAGGAGACTCGCAGTGGG + Intergenic
1153139307 18:1954179-1954201 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
1154357486 18:13633013-13633035 GCAGAGAGGAGACCCATAGAGGG + Intronic
1155120631 18:22815963-22815985 GCTCAGAGGAGACCTGCAGTGGG + Intronic
1156160409 18:34351535-34351557 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1156298732 18:35817437-35817459 ACTCAGAGGAGACCCGCAGTGGG + Intergenic
1156654734 18:39271846-39271868 CCCCAGAGGAGACCTGGAGCGGG - Intergenic
1157006382 18:43589425-43589447 GCTCAGAGGAGAGCCACAGTGGG + Intergenic
1157042847 18:44060837-44060859 GCTCAGAGAAGACCCACAGTAGG + Intergenic
1157322694 18:46646643-46646665 GGGCAGAGGAGGCCTGTAGCTGG - Intronic
1158023336 18:52869267-52869289 GCTCAGAGGAGACCCACAGTAGG + Intronic
1158139401 18:54241395-54241417 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1158198015 18:54910087-54910109 GCTCAGAGGAAACCTGCAGGGGG + Intronic
1158633045 18:59132661-59132683 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1159189025 18:65017586-65017608 GCTCAGAGGAGACTCGCAATGGG + Intergenic
1161169997 19:2807842-2807864 GCTCCGAGGAGACCCAGGGCCGG - Intronic
1161666724 19:5581638-5581660 GGTCAGAGGAGACCTCTTGCAGG + Intergenic
1162231658 19:9271364-9271386 GCTTAGAGGAGACCCACAGTGGG - Intergenic
1162510169 19:11113228-11113250 GGTCAGAGGGGACCCGTCGATGG - Intronic
1162549659 19:11351482-11351504 GCTCAGGGGAGACAGGTGGCTGG + Intronic
1163935512 19:20439020-20439042 GATCAGAGCAGAACCCTAGCAGG - Intergenic
1165022700 19:32936931-32936953 GTTCAGAGGAGACCCACAGTGGG - Intronic
1166898188 19:46037039-46037061 GCTCAGAAGAGACCCACAGTGGG - Intergenic
1167013223 19:46822400-46822422 GCTCAGAGGAGACCGTCAGTGGG - Intergenic
1167066105 19:47187242-47187264 GCTCAGAGGAGTGACATAGCTGG - Intronic
1167235115 19:48309513-48309535 GCTCAGAGGAGACCTGCAGGGGG - Intronic
1167346290 19:48947449-48947471 GCTCAGGGGAGACCCGCAGTGGG - Intergenic
1168633440 19:57975304-57975326 GCACAGGGGAGACCCACAGCAGG + Intergenic
1168714790 19:58520343-58520365 GCTCAGGGGAGGCCCAGAGCAGG - Intronic
1202632820 1_KI270706v1_random:15962-15984 GCTCAGAGGAGACGTGCAGTGGG + Intergenic
1202653058 1_KI270707v1_random:24087-24109 GCTCAGAGGAGAACTGCAGTGGG - Intergenic
1202659093 1_KI270708v1_random:51658-51680 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
924963932 2:58315-58337 GCTCAGAGGAGACCCACAGGTGG - Intergenic
925067973 2:943888-943910 GCTCAGAGGACACCCGCAGGGGG + Intergenic
926554595 2:14342076-14342098 GCTCAGAGGAGACCCGCAATGGG - Intergenic
926953626 2:18271302-18271324 GCTCAGAGGAGAAACGCAGTGGG + Intronic
928723548 2:34147165-34147187 GCTCAGAGGAGTCCTGCAGTGGG + Intergenic
928823464 2:35391406-35391428 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
930612073 2:53554603-53554625 GCTCAGAGGAAACCTGCAGTAGG - Intronic
930729058 2:54709921-54709943 GCTCAGAGGAGACCCGCAGTAGG - Intergenic
930800607 2:55438810-55438832 GCTCAGAGGAGACCTGTAGTGGG - Intergenic
930971147 2:57397362-57397384 GCTCCGAGGAGACCTGCAGTGGG + Intergenic
931500131 2:62856038-62856060 GCTCAGAGGAGACTCGCAGTGGG - Intronic
932054670 2:68432294-68432316 GCTCAGAGGAGAACCACAGTAGG + Intergenic
933093352 2:78147135-78147157 GCTCAGAAGACACCCGCAGTGGG - Intergenic
933113104 2:78429634-78429656 GCTCAGAGGAGACTCACAGTGGG - Intergenic
933383773 2:81583984-81584006 GATCAGAGGAGACCCGCAGTGGG - Intergenic
934490653 2:94760346-94760368 GCTCAGAGGGCACCCGTATCTGG - Intergenic
937163981 2:119794893-119794915 GCTCAGAGGAGACCTGCAGTGGG + Intronic
937976361 2:127584369-127584391 TCCAAGAGGAGACCCATAGCAGG - Intronic
938180607 2:129178947-129178969 GCTCAGAGGAAACCCTCAGGGGG + Intergenic
940694212 2:156959030-156959052 GCTCAGAAGAGACCCACAGTGGG + Intergenic
941043664 2:160649400-160649422 GCTCAGAGGAGACCCGCAATGGG - Intergenic
942053431 2:172162096-172162118 GCTCAGAGGAGACTCGCAGTGGG + Intergenic
942585000 2:177466023-177466045 GCTCAGAGGAGACTCATATTGGG + Intronic
943191046 2:184680245-184680267 GCAGAGAGGAGACCCGCAGTGGG - Intronic
943345611 2:186734296-186734318 GCAGAGAGGAGACCCAGAGCGGG + Intronic
943363422 2:186947225-186947247 GCTTAGAGGAGACCAGGAGAGGG + Intergenic
943426954 2:187749630-187749652 GCTCAGAGGAGACTCACAGTGGG + Intergenic
943453265 2:188072490-188072512 TCTGAGAGGAGATCCGTTGCAGG + Intergenic
944483877 2:200182834-200182856 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
944586722 2:201179303-201179325 GCTCAGAGGAGGCCCACAGTGGG - Intergenic
946158931 2:217824361-217824383 GCTCACAGGACACCCAGAGCTGG + Intronic
946197373 2:218043098-218043120 GCTCGGAGGAGACCTGCAGTAGG + Intronic
947316731 2:228866775-228866797 GCTCAGAGGAGACCTGCACTGGG - Intronic
947765150 2:232633316-232633338 GCTCCGGGGAAAACCGTAGCGGG - Exonic
948293550 2:236845003-236845025 GCTCAGAGGAGACCCACAGTAGG + Intergenic
948334890 2:237200212-237200234 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
948575347 2:238946369-238946391 GCTCAGAGGAGACCCACAGTGGG + Intergenic
948713046 2:239837090-239837112 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
948953860 2:241272526-241272548 GCGCAGAAGAGACTCGGAGCCGG + Intronic
1170004232 20:11647480-11647502 GCTCAGAGGAAACCTTTAGCAGG - Intergenic
1170043802 20:12065121-12065143 GCTCAGAGGAAACCCACAGGGGG + Intergenic
1170458415 20:16554469-16554491 GCTCAAAGGAGACCCGCACTGGG - Intronic
1171536805 20:25899440-25899462 GCTCAGAGGAGATCCATAGTGGG - Intergenic
1171804305 20:29661717-29661739 CCTCAGAGGAGACCCATAGTGGG + Intergenic
1171839747 20:30194705-30194727 GCTCAGAGGAGACCCATAGTGGG - Intergenic
1173207555 20:41006789-41006811 GCTCAGAGGAGACTCACAGTGGG + Intergenic
1173718604 20:45233270-45233292 GCTCAGAGGAGACCTGTAGTGGG - Intergenic
1174442625 20:50568078-50568100 TCTCAGTGGAGGCCCTTAGCGGG + Intronic
1175064417 20:56272898-56272920 GCTCAGGGGAGACCTGCAGTGGG - Intergenic
1175065146 20:56277791-56277813 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1175553331 20:59831038-59831060 GCACAGAGGAGACAGGGAGCAGG - Intronic
1175665360 20:60854045-60854067 GCACAGAGGAGACTCGTGCCAGG + Intergenic
1175959878 20:62630644-62630666 GCTCAGAGGAGACCCGCCGTGGG + Intergenic
1176104631 20:63380185-63380207 GCTCAGAGGCGACCCGCAGTGGG - Intergenic
1176582259 21:8542849-8542871 GCTCAGAGGAGACCCATAGTGGG + Intergenic
1176599095 21:8775564-8775586 GCTCAGAGGAGAACTGCAGTGGG + Intergenic
1176628968 21:9119500-9119522 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1176645034 21:9341842-9341864 GCTCAGAGGAGACGTGCAGTGGG + Intergenic
1176973219 21:15289847-15289869 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1176976559 21:15327577-15327599 GCTCAGAGGAGACCTGCAATGGG - Intergenic
1176993074 21:15521867-15521889 GTTCAGAGGAGACCTGTAGTTGG + Intergenic
1177262644 21:18750330-18750352 GCTCAGAGGAGACCCACAGTAGG - Intergenic
1177357780 21:20031385-20031407 CCTCAGAGGAGACCCACAGTGGG + Intergenic
1177396038 21:20537753-20537775 GCTCAGAGGAGACTTGCAGTGGG + Intergenic
1177624835 21:23646391-23646413 GCTGAGAGGAGACCCACAGTGGG + Intergenic
1178244447 21:30937065-30937087 GCTCAGAAGAGACCTGCAGTGGG - Intergenic
1180178869 21:46108955-46108977 GCTCACAGGAGACCCGCAGGGGG + Intronic
1180265094 22:10519897-10519919 GCTCAGAGGAGACCCATAGTGGG + Intergenic
1180367917 22:11957392-11957414 GCTCAGAGGAGACGTGCAGTGGG - Intergenic
1180378171 22:12113944-12113966 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
1180419335 22:12799337-12799359 GCTCAGAGGAGAACTGCAGTGGG - Intergenic
1180875536 22:19173515-19173537 GCAGAGAGGAGGCCCGCAGCAGG - Intergenic
1181442382 22:22943324-22943346 GCACAGAGGAGAGCCGTTTCTGG - Intergenic
1182028681 22:27140118-27140140 TCTCAGAGGAGACCGGTGCCAGG - Intergenic
1182622166 22:31624147-31624169 GCTGAGAGGTGCCCCGCAGCTGG - Intronic
1183024922 22:35057891-35057913 GCTCAGAGGAGACTTGCAGTGGG + Intergenic
1184173924 22:42775302-42775324 GCTCAGAGGAGACCCGCAGTGGG - Intergenic
1184514557 22:44954025-44954047 GCTCAGAGCAGACCCCCAGTGGG + Intronic
1184665743 22:45988036-45988058 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1184865786 22:47201298-47201320 GCTCAGAGAAGACCCACAGGGGG + Intergenic
949884210 3:8681376-8681398 GCTCTGAGGACACCCATCGCAGG + Intronic
950153711 3:10707584-10707606 GCTCGGAGCAGCCCCGGAGCTGG - Intronic
950207652 3:11092905-11092927 ACTCAGAGGAGACCTGCAGTGGG - Intergenic
950993547 3:17468099-17468121 GGTCAGAGGAATCCAGTAGCAGG + Intronic
951182236 3:19672050-19672072 GCTCAGAGGAGACCAGCAGTGGG + Intergenic
951264665 3:20552169-20552191 GATCAGAGGAGACCTGCAGTGGG + Intergenic
951562377 3:23981764-23981786 GCTCAGAGGGGACCTGCAGTGGG + Intergenic
952016195 3:28959579-28959601 GCTCAGAGGAGACCCAAGGTGGG - Intergenic
952269313 3:31816759-31816781 GCTCAGAGGAGACCCGTAGCGGG + Intronic
952793383 3:37217921-37217943 GCTCAGAGGAGACCGGCATTGGG - Intergenic
953586626 3:44207033-44207055 GCTGAGAGGAGCCACGGAGCCGG - Intergenic
954099311 3:48357347-48357369 GCTCAGAGGAGACCCACAGTGGG + Intergenic
954498081 3:50983631-50983653 GCTCAGAGGAGACTCACAGTGGG - Intronic
954737066 3:52715364-52715386 GCTCAGAGGAGATCCGCAGGGGG - Intronic
956257341 3:67297670-67297692 CCTCAGATGGGACCAGTAGCTGG - Intergenic
957076970 3:75609877-75609899 GCTCTAAGGAGCCCCGTCGCAGG - Intergenic
957095286 3:75772130-75772152 GCTGAGAGGAGACCCATGGTGGG - Intronic
957095295 3:75772203-75772225 GCTCAGAGGAGACCTGCAGGGGG - Intronic
957486738 3:80871262-80871284 GCAGAGAGGAGACCCGCAGTGGG - Intergenic
957705198 3:83770823-83770845 GCTTAGAGGAGACCCACAGTGGG - Intergenic
958141774 3:89571245-89571267 GCAGAGAGGAGACCCGGAGTGGG + Intergenic
958195376 3:90236145-90236167 GCTCAGAGGAGACCCTCAGTGGG - Intergenic
958418795 3:93907560-93907582 GCTCAGAGGAGACCCTCAGTGGG - Intronic
958572892 3:95911268-95911290 GCTCAGAGGAGACCCACAGTGGG + Intergenic
958675510 3:97264760-97264782 GCTCTGAGGAGACCCACAGTGGG + Intronic
958678099 3:97292832-97292854 GCAGAGAGGAGACCCGTGGTGGG + Intronic
959484326 3:106909265-106909287 GTTCAGAGGAGACCTGCAGAGGG - Intergenic
959863617 3:111242561-111242583 GCTCACAGGAGACCTGCAGGAGG + Intronic
960333907 3:116392995-116393017 GCTCAGAGGAGACCCCCAGTGGG - Intronic
960634194 3:119767816-119767838 GCTCAGAGGAGACCCACAGTGGG + Intergenic
961311435 3:126004382-126004404 GCTCTCAGGAGACCCGGAGTGGG - Intergenic
961525849 3:127496863-127496885 GCTCAGAGGAGACCAGCAGTTGG - Intergenic
961942925 3:130656344-130656366 GCTCAGAGGAGACCTGCAGTGGG + Intronic
962211966 3:133486901-133486923 GCTCAGAGGAGACCCACAGTGGG + Intergenic
963067412 3:141274483-141274505 TCCCAGAGGAGACACCTAGCTGG - Intronic
963805205 3:149715042-149715064 GCTCAGAGGAGACCTGCAGTGGG - Intronic
964791754 3:160459884-160459906 GCTCAGAGGATCCCCGCAGTGGG + Intronic
964927805 3:161978778-161978800 GCAGAGAGGAGACCCGGAGTGGG + Intergenic
965005684 3:163019513-163019535 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
965118566 3:164521781-164521803 GATCAGAGGAGACCCACAGTGGG + Intergenic
965118587 3:164521918-164521940 GCTGAGAGGAGACCCACAGTGGG + Intergenic
965309851 3:167115281-167115303 GCTCAGAGGAAACCTGCAGGGGG + Intergenic
965541478 3:169875636-169875658 GCTCAGAGGAGACCCACAGTGGG - Intergenic
965669563 3:171133093-171133115 TCTCAGAGGTGACCCGGAGCAGG - Intronic
967222083 3:187255917-187255939 GCTCAGAAGAGACCCTGAGCTGG - Intronic
1202741857 3_GL000221v1_random:63226-63248 GCTCAGAGGAGACGTGCAGTGGG - Intergenic
969274900 4:6128432-6128454 GCTCAGAAGGGACCAGGAGCGGG + Intronic
970959713 4:21857632-21857654 GCTCAGAGGAGACCCACAGTGGG - Intronic
971079782 4:23196003-23196025 GCTCAGAGGAGACCCACAGTGGG - Intergenic
971714041 4:30153055-30153077 GCTCAGAGGAGACCTACAGTGGG + Intergenic
972072612 4:35039278-35039300 GCTCAGAGGAGACCTGCAGTTGG - Intergenic
972106513 4:35494761-35494783 GCTCAGAGGAGACCCACAGTGGG - Intergenic
972128715 4:35802423-35802445 GCTCAGAGGAAACCCACAGGGGG - Intergenic
972645879 4:40967179-40967201 GCTCAGAGGAGACCCACAGTAGG - Intronic
973362451 4:49177936-49177958 GCTCAGAGGAGAACTGCAGTGGG + Intergenic
973398649 4:49618925-49618947 GCTCAGAGGAGAACTGCAGTGGG - Intergenic
974235840 4:59180022-59180044 GCTGAGAGGAGACCCACAGTCGG - Intergenic
974278439 4:59758899-59758921 GCTCAGAGAAGACCTGCAGTGGG + Intergenic
974285091 4:59855539-59855561 GCTCAGAGGACACCTGCAGTGGG + Intergenic
974628940 4:64458145-64458167 GCTCTCAGGAGACCCATAGTGGG - Intergenic
974686792 4:65241869-65241891 GCAGAGAGGAGACCCGTAGTGGG + Intergenic
974894910 4:67927044-67927066 GCTCACAGGAGACCCACAGTGGG - Intronic
975044452 4:69783998-69784020 GCTCAGAGAAGACCCACAGTGGG - Intronic
975221151 4:71814233-71814255 GCTCAGAGGAGAACTGCAGTGGG + Intergenic
975321373 4:73012419-73012441 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
975913716 4:79298172-79298194 GCTCAGGGGAGACCTGCAGGGGG - Intronic
976027757 4:80711312-80711334 GCTCAGAGGAGCCACAGAGCTGG + Intronic
976097780 4:81527814-81527836 GCTCAGAGGAGACCTGCAGTGGG + Intronic
976647392 4:87400201-87400223 GCTCAGAGGAGACCCACAGTGGG - Intergenic
976675416 4:87697464-87697486 GCTCAGTGGAGAACTGCAGCAGG + Intergenic
976679876 4:87745147-87745169 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
976815803 4:89147977-89147999 GCTCAGAGGAGACCTGCGGTGGG + Intergenic
976921443 4:90449200-90449222 GCTAAGAGGAGACCCACAGTGGG + Intronic
977359143 4:95981462-95981484 GCTCAGAGGAAACCCACAGCAGG - Intergenic
977568831 4:98609608-98609630 GCTCAGAGTAGACCTGCACCTGG - Intronic
977645879 4:99410786-99410808 GCTCAGAGGAGACTTGCAGTGGG + Intergenic
977816200 4:101416605-101416627 GCTCAGAGGAGACCCATGGTAGG + Intronic
978229851 4:106385509-106385531 GCTCAGAGAAGACCCACAGTGGG + Intergenic
978248524 4:106604043-106604065 ACTCAAAGGAGACCCGCAGTGGG + Intergenic
978249318 4:106610975-106610997 GCTCAGAGGAGACCCACAGCAGG - Intergenic
978498510 4:109384871-109384893 GCTCAGAGGAGACTCACAGTGGG - Intergenic
979462910 4:121003775-121003797 GCTCAGAGGAGACCCACAGGGGG - Intergenic
979637909 4:122978270-122978292 GCGGAGAGGAGACCCGGAGTGGG + Intronic
980180291 4:129393083-129393105 GCTCAGAGGAAACTCGCAGTGGG - Intergenic
980450269 4:132960118-132960140 GCTCAGAGGAGACCCAGAGTGGG - Intergenic
980671184 4:136008909-136008931 GCTCAGAGGAGACCCATATTGGG - Intergenic
980729771 4:136811271-136811293 GCTCAGAGGAAACCTGCAGAGGG + Intergenic
980745000 4:137001360-137001382 GCTCAGAGGAGACCCGTAGTGGG - Intergenic
981889162 4:149715731-149715753 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
982611096 4:157575086-157575108 GCTCAGAGGAGACCTGCATTGGG - Intergenic
983000532 4:162408918-162408940 GCTCAGAGGAGACCCACAGTGGG + Intergenic
983125802 4:163949631-163949653 GCTCAGAGGAGACCCACAGTGGG + Intronic
983380076 4:166981143-166981165 GCCCAGAGGAGACCCATAGTGGG + Intronic
983431041 4:167651977-167651999 GCTTGGAGGAGACCCGTAGAGGG - Intergenic
983491965 4:168399035-168399057 GCTCAGAGGAGACCTGCAGTGGG - Intronic
983651512 4:170040851-170040873 GCTCAGAGGAGAGCCACAGTGGG - Intergenic
983715496 4:170776708-170776730 GCTCAGAGGAGACCCACAGTGGG - Intergenic
983784607 4:171715768-171715790 GCTCAGAGGAGGCCTGCAGGGGG - Intergenic
984102079 4:175499116-175499138 GCTCAGAGGAGATCCACAGGGGG + Intergenic
984296700 4:177862390-177862412 GCTCAGAGGAGACCCACAGTTGG - Intronic
984325254 4:178242448-178242470 GCTCAGAGGAGACCTGTAGTGGG - Intergenic
1202759788 4_GL000008v2_random:99409-99431 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
986503817 5:8429425-8429447 GCTTAGAGGAGACCCACAGTAGG + Intergenic
986923564 5:12717687-12717709 GCTCAGAGGAGACTCACAGTGGG - Intergenic
987951893 5:24686982-24687004 GCTCAGAGGAGAACCACAGTGGG + Intergenic
988565865 5:32319839-32319861 GCTCAGAGGAGATCCACAGTGGG + Intergenic
989339203 5:40354912-40354934 GCTCAGAGGAGACCTGCAGTAGG - Intergenic
990023789 5:51160342-51160364 GCTTAGAGGAGACCAGCAGTGGG - Intergenic
991575418 5:68098529-68098551 GCCCTGATGAGCCCCGTAGCAGG - Intergenic
992693071 5:79259017-79259039 ACTCAGAGGAGACCTGTAGTGGG + Intronic
994692344 5:103034448-103034470 GCTGAGAGGAGACCCACAGTGGG + Intergenic
994692354 5:103034516-103034538 GCTGAGAGGAGACCCACAGTGGG + Intergenic
995744917 5:115393360-115393382 GCTCAGAGGAGACCCGCAGTGGG + Intergenic
996923790 5:128799727-128799749 GCTCAGAGGAGACCCACAGTAGG + Intronic
997960493 5:138316850-138316872 GCTCAGAGGAGACCCACAGGGGG - Intronic
998480515 5:142459114-142459136 GCTGAGAGGAGACCCACAGTGGG + Intergenic
1000266317 5:159641374-159641396 GCTCAGAGGAGATCTGCAGTGGG - Intergenic
1000385965 5:160675105-160675127 GCCCAGGGGAGACCAGCAGCTGG + Intronic
1000426265 5:161094144-161094166 GCTCAGAGGAGACATGCAGTAGG - Intergenic
1002986279 6:2192290-2192312 GCTCAGAGAAGACCCACAGTGGG - Intronic
1004304560 6:14488115-14488137 GCTCAGAGGAAACCCGCACTGGG - Intergenic
1005021413 6:21422997-21423019 GCTCAGAGGAGACCGACAGTGGG + Intergenic
1005258862 6:24035125-24035147 GCTCAGAGGAGCCGCAAAGCCGG - Intergenic
1005775898 6:29130377-29130399 GCTCAGAGGAGACACATAGAGGG - Intergenic
1006348022 6:33498639-33498661 GGTCAGAGGAGACCCACAGTGGG - Intergenic
1006463766 6:34178902-34178924 GCTCTCAGGAGACCCGGAGTGGG + Intergenic
1006500989 6:34458614-34458636 GCTCAGAAGAGACCCGCAGTGGG - Intergenic
1006753817 6:36397054-36397076 GCTCAGAGGAGATCCGCAGTGGG - Intronic
1008330612 6:50240482-50240504 GCTCAGAGGAGACTCATAGTGGG + Intergenic
1009643058 6:66362555-66362577 GCTCTCAAGAGACCCATAGCAGG + Intergenic
1009846855 6:69145680-69145702 GCTCAGAGGAGACCTTCAGTGGG + Intronic
1010341171 6:74754940-74754962 GCTCAGAGGAGACCAGCAGAGGG - Intergenic
1010489095 6:76452789-76452811 GCAAAGAGGAGACCCGAAGTGGG + Intergenic
1011795608 6:90948249-90948271 GCTCAGAAGAGACCCGCAGTGGG - Intergenic
1011822586 6:91271198-91271220 GCTCTCAGGAGACCTGTAGTGGG + Intergenic
1012052214 6:94360958-94360980 GCCCAGAGAAGACCCGCAGTGGG + Intergenic
1012122415 6:95384696-95384718 GCTCAGAGGAGACCCACATTGGG - Intergenic
1012169519 6:96001788-96001810 GCTCAGAGGAGACCCACAGAGGG + Intergenic
1012752814 6:103184509-103184531 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1013235997 6:108198426-108198448 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1013375598 6:109510642-109510664 GCTCAGAGGAGACCCACAGTGGG - Intronic
1013709381 6:112879798-112879820 GCTCAGAGGAGACCCGCAGGGGG + Intergenic
1014078802 6:117265841-117265863 CCCCAGAGGAGACACGTACCTGG - Exonic
1014227118 6:118861540-118861562 GCTCTCAGGAGACCCGAAGTGGG + Intronic
1014388913 6:120836443-120836465 TCTCAGAGGATACCTGTAGAAGG + Intergenic
1014662770 6:124193761-124193783 GCACAAAGGAGACCCACAGCGGG + Intronic
1015061905 6:128976373-128976395 GCTCAGGGGAGAACTCTAGCTGG + Intronic
1015455599 6:133423968-133423990 GCTCAGAGGAGACCCACAGTGGG + Intronic
1015663787 6:135604221-135604243 GCTCAGAGGAAACCCTCAGAGGG - Intergenic
1017420446 6:154267633-154267655 GCTCAGAGAAGACCCATAGTGGG + Intronic
1017522309 6:155213274-155213296 GCTCAGAGGAAACCCACAGTGGG + Intronic
1019288272 7:234479-234501 GCTCAGAGGAGTCCCGGTCCTGG - Intronic
1019897868 7:3997312-3997334 GCCCAGAGGAGCCCCGCAGTGGG + Intronic
1020586829 7:10079345-10079367 GCTCAGAGGAGACCTGCAGATGG - Intergenic
1020649311 7:10855329-10855351 GCTCAGAGGAGACCCGCAGTGGG - Intergenic
1020761297 7:12270304-12270326 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1021343087 7:19488776-19488798 GCAGAGAGGAGACCCAGAGCAGG + Intergenic
1021431115 7:20560067-20560089 GCTGAGAGGAGACCCACAACGGG + Intergenic
1021939503 7:25665711-25665733 GCTCAGAGGAGAGCCTAAGCTGG + Intergenic
1022391923 7:29950764-29950786 GCAGAGAGGAGACCTGTAGTGGG - Intronic
1023699983 7:42883223-42883245 GCTCAGAGGAGACCTGCAATGGG + Intergenic
1026370137 7:69690988-69691010 GCAGAGAGGAGACCCATAGTGGG + Intronic
1027333667 7:77126463-77126485 GCTCAGAGGAGACCCACAGTGGG + Intronic
1027924878 7:84447628-84447650 GCTCTTAGGAGACCCGAAGTGGG - Intronic
1028024642 7:85821696-85821718 GCTCAAATGAAACCCATAGCGGG - Intergenic
1028053066 7:86208589-86208611 GCAGAGAGGAGACCCACAGCAGG + Intergenic
1028136809 7:87230926-87230948 GCTCTCAGGAGACCCGAAGTGGG - Intergenic
1028527358 7:91801037-91801059 GCTCAGAGGAGACCCACAGAGGG + Intronic
1029032258 7:97481040-97481062 ACTCAGATGAGATACGTAGCAGG + Intergenic
1029324540 7:99794749-99794771 GCTCAGAGGAGACCAGACCCTGG + Intergenic
1029782126 7:102744869-102744891 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1030783119 7:113625872-113625894 GCTCAGATGAGAAAAGTAGCTGG - Intergenic
1031242024 7:119257964-119257986 GCTCAGAGGAGACCTGCAGGTGG + Intergenic
1031265339 7:119573169-119573191 GCTCAGAGAAGACCTGCAGTGGG - Intergenic
1031743672 7:125467851-125467873 GCTCAGAGGAGACCAGCACTGGG + Intergenic
1031836996 7:126690752-126690774 ACTCAGAGGAGACCTGCAGTGGG + Intronic
1032658283 7:133955254-133955276 GCTCAGTGGAGACCTGCAGTGGG + Intronic
1032858566 7:135857735-135857757 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1032919230 7:136527214-136527236 GCTCACAGGAGACCCAGAGTGGG + Intergenic
1034101759 7:148456980-148457002 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
1034210359 7:149357873-149357895 GCTCAGAGGAAACCCACAGTCGG + Intergenic
1035495514 7:159322131-159322153 GCTCAGAGGAGTGAGGTAGCAGG + Intergenic
1036497325 8:9281104-9281126 GCTCAGGGGAGACCAGTAGGGGG + Intergenic
1037553928 8:20004143-20004165 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1039182264 8:34880167-34880189 GCTCAGAGGAGGCCCGCAGTGGG + Intergenic
1040725592 8:50378580-50378602 GCTCAGAGGAAAGCCACAGCAGG + Intronic
1041205457 8:55494558-55494580 GCTCAGAGGAGACCCAAAGTGGG + Intronic
1041965433 8:63669973-63669995 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1042336996 8:67639863-67639885 GCTCAGAGGAGACCTATAGTGGG + Intronic
1042687806 8:71461746-71461768 GCTCAGAGGAGATCCTGAGGGGG + Intronic
1043180538 8:77082605-77082627 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
1043180547 8:77082675-77082697 GCAGAGAGGAGACCCGTGGTAGG + Intergenic
1044008637 8:86965802-86965824 GCTCAGAGGAGACCTGCAGCAGG + Intronic
1044409614 8:91868640-91868662 GCTCAGAGGAGACCCACAGGAGG - Intergenic
1044412627 8:91901646-91901668 GCTCAGAGGAGACCCAGAGTGGG + Intergenic
1044774903 8:95677909-95677931 GCTCAGAGGAGACTCACAGTGGG + Intergenic
1044962389 8:97543236-97543258 GCTCAGAGGAGACCTGCAATGGG - Intergenic
1046140465 8:110083780-110083802 ACTCAGAGGAGACCCCCAGTGGG - Intergenic
1046395215 8:113632379-113632401 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1046407289 8:113790889-113790911 GCTCTGAGGAGACCCACAGTTGG + Intergenic
1046503703 8:115111223-115111245 GCTCAGAAGAGACCTGCAGTGGG + Intergenic
1046674616 8:117094360-117094382 GCTCAGAGGAGACCCGCAGTGGG + Intronic
1048938703 8:139378030-139378052 CCTCAGAGGAGACCTGCAGAAGG + Intergenic
1049721271 8:144116540-144116562 GGGCAGAGGAGACCCATAGCGGG + Exonic
1049824069 8:144655640-144655662 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1050182379 9:2934690-2934712 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1050725547 9:8644325-8644347 GCTCAGAGGAGACCCATAGTGGG - Intronic
1050937264 9:11413963-11413985 GCTCAGAGGAGATCCACAGTGGG - Intergenic
1052580587 9:30349589-30349611 GCTCTGAGGAGACCTGAAGTGGG + Intergenic
1052652344 9:31321113-31321135 GCTCAGAGGAGACCCACACTGGG + Intergenic
1052881461 9:33603171-33603193 GCTCAGAGGGCACCTGTATCTGG + Intergenic
1053445101 9:38146582-38146604 GCTCAGAGGAGACCCGCAGTGGG - Intergenic
1053494857 9:38542670-38542692 GCTCAGAGGGCACCTGTATCTGG - Exonic
1053617437 9:39782095-39782117 GCTCAGAGAAGACCCACAGTGGG - Intergenic
1053619129 9:39798413-39798435 GCTCAGAGGAGACCCGCAGTGGG + Intergenic
1053875619 9:42541458-42541480 GCTCAGAGAAGACCCACAGTGGG - Intergenic
1053877284 9:42557762-42557784 GCTCAGAGGAGACCCGCAGTGGG + Intergenic
1053895381 9:42736926-42736948 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1054234409 9:62543960-62543982 GCTCAGAGGAGACCCGCAGTGGG - Intergenic
1054236080 9:62560266-62560288 GCTCAGAGAAGACCCACAGTGGG + Intergenic
1054265028 9:62909016-62909038 GCTCAGAGGAGACCCGCAGTGGG - Intergenic
1054266729 9:62925342-62925364 GCTCAGAGAAGACCCACAGTGGG + Intergenic
1054550222 9:66594796-66594818 GCTCAGAGAAGACCCACAGTGGG + Intergenic
1055645495 9:78357981-78358003 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1055890865 9:81122409-81122431 GCTCAGAGGTGACCTGCAGTGGG + Intergenic
1056191983 9:84194086-84194108 GCTCAGAGGAGACCCACAATGGG + Intergenic
1056462198 9:86818762-86818784 GCTCAGAGGAGACCTGGAGATGG - Intergenic
1056986174 9:91365017-91365039 GCTCGGAGGAGACCCGCAGTGGG - Intergenic
1057354307 9:94321770-94321792 GGTCAGGGGAGACCTGTACCTGG - Intronic
1057653457 9:96935865-96935887 GGTCAGGGGAGACCTGTACCTGG + Intronic
1058510850 9:105714264-105714286 GCTCAGAGAAGACCCACAGTGGG - Intronic
1060618842 9:125044524-125044546 GCTCTCAGGAGACCCCTAGTAGG - Intronic
1061004083 9:127918497-127918519 GCTCAAAGGAGGCCCCTAGGGGG - Intergenic
1061302252 9:129712089-129712111 TCTCAGAGGAGCCTCGGAGCTGG - Intronic
1061743196 9:132722287-132722309 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
1062184778 9:135212140-135212162 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1062329156 9:136029276-136029298 GCTGAGAGGAGACCCACAGTGGG - Intronic
1203691579 Un_GL000214v1:47624-47646 GCTCAGAGGAGACCTGCAGTCGG + Intergenic
1203751813 Un_GL000218v1:87181-87203 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1203710487 Un_KI270742v1:93150-93172 GCTCAGAGGAGACGTGCAGTGGG - Intergenic
1203540564 Un_KI270743v1:84304-84326 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
1203612277 Un_KI270749v1:20863-20885 GCTCAGAGGAGACCCATAGTGGG + Intergenic
1203644716 Un_KI270751v1:56567-56589 GCTCAGAGGAGACCTGCAGTCGG - Intergenic
1188756569 X:33969796-33969818 GCTCAGAGGAGACGCTCAGTGGG - Intergenic
1189023929 X:37371314-37371336 GCTCAGAGGAGACCCACATTGGG - Intronic
1190369550 X:49727601-49727623 GCTCAGAGAAGACCCATAGTGGG - Intergenic
1190681793 X:52832003-52832025 GCTCAGAGGAGATCCGCAGTGGG - Intergenic
1191016396 X:55813995-55814017 GCTCAGAGGAGACCCAAAGTGGG - Intergenic
1191102449 X:56746527-56746549 GGTCTGATGAGACCCATAGCAGG - Intergenic
1192265286 X:69533488-69533510 GCTCAGAGGGGACCCACAGTGGG + Intergenic
1193108375 X:77703801-77703823 GCTCAGAGGAAACCCAAAGGGGG + Intronic
1193468690 X:81875016-81875038 GCTCAGAGAAGACCTGCAGTGGG + Intergenic
1193554213 X:82933028-82933050 GCTCAAAAGAGACCCGCAGTGGG - Intergenic
1194379411 X:93175564-93175586 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1194380354 X:93182272-93182294 GCTCAGAGGAGACCCTCAGTGGG - Intergenic
1195178485 X:102333793-102333815 GCTCAGAGGATACCCGAAGGGGG + Intergenic
1195180379 X:102353290-102353312 GCTCAGAGGATACCCGAAGGGGG - Intergenic
1195655079 X:107325226-107325248 GCTCAGAGAAGACCTGCAGGGGG - Intergenic
1196389140 X:115190727-115190749 GCTCACACGAGGCCCGCAGCGGG + Exonic
1197035703 X:121870763-121870785 GCTGAGAGGAGACCCACAGTGGG - Intergenic
1197378458 X:125710216-125710238 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1197421324 X:126238828-126238850 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1197795937 X:130299064-130299086 ACTCAGAGGAGACCCGCAGTGGG + Intergenic
1199187946 X:144939064-144939086 GCTCAGAGGAGACCTACAGTGGG + Intergenic
1199861072 X:151800989-151801011 GCTCAGAGGAGACCCGCAGGGGG + Intergenic
1200886871 Y:8279916-8279938 GCACACAGGAGCCCAGTAGCCGG - Intergenic
1201165467 Y:11204801-11204823 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1202018145 Y:20434213-20434235 GCTCAGAGAAGACCTGCAGTTGG + Intergenic