ID: 952271211

View in Genome Browser
Species Human (GRCh38)
Location 3:31833458-31833480
Sequence CCTGACATGCAGAAGCTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 323}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952271209_952271211 24 Left 952271209 3:31833411-31833433 CCATGAAGTTTAAATTAGATTAT 0: 1
1: 0
2: 9
3: 76
4: 577
Right 952271211 3:31833458-31833480 CCTGACATGCAGAAGCTGCATGG 0: 1
1: 0
2: 4
3: 19
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952271211 Original CRISPR CCTGACATGCAGAAGCTGCA TGG Intronic
900464497 1:2818451-2818473 CCTGCCCTGCAGGGGCTGCAGGG + Intergenic
901144244 1:7054296-7054318 CCAGACATGCAGAGGCGGCCTGG - Intronic
901221786 1:7587564-7587586 CCTGACATGGGGAAGCTGCGAGG - Intronic
901693118 1:10986943-10986965 CCTGAGAGGCAGAAGGTGAATGG + Intergenic
902674487 1:17999339-17999361 CCTGCCATGGAGCAGCTTCATGG - Intergenic
902713008 1:18253434-18253456 TCAGCCTTGCAGAAGCTGCATGG + Intronic
903366624 1:22809203-22809225 GATGAGTTGCAGAAGCTGCAGGG + Intronic
903754611 1:25652180-25652202 CCTGACATGCGGCAGCAGGAAGG - Intronic
904377061 1:30088316-30088338 CCTGGCCTGCAGAAGGAGCAGGG - Intergenic
905637347 1:39563608-39563630 CCTCACCTGCAGAGGCTGTATGG + Exonic
907499953 1:54871778-54871800 CATGTCATGTCGAAGCTGCAGGG - Intronic
907519337 1:55012904-55012926 CCTGACACTCAGCAGCTGCCTGG - Intergenic
907712954 1:56901413-56901435 ACAGACATGCAGAAGCTCCATGG + Intronic
907741439 1:57170070-57170092 CCTGGGATGCAGAGGTTGCAGGG - Intronic
908002275 1:59691960-59691982 CCTGACATAGAGTAGCTGCTTGG + Intronic
908177790 1:61572867-61572889 CCTGAGAAGCAGCACCTGCATGG + Intergenic
909244167 1:73255934-73255956 TTTTACATGCAGAAGCTGAAAGG + Intergenic
909245954 1:73284681-73284703 CCTAATATCCAGAATCTGCAAGG + Intergenic
909852869 1:80490946-80490968 ACTGACAGGCAGAAGCTACATGG + Intergenic
910349430 1:86278358-86278380 CATGCCATGCAGCAGCTGCCAGG + Intergenic
911235505 1:95407636-95407658 CCGGGCAAGCAGACGCTGCAGGG - Intergenic
911618902 1:100044589-100044611 CCTGAGAGGCAGAGGTTGCAGGG - Intronic
914470514 1:147973547-147973569 CCTAACATCCAGAATCTACAAGG - Intronic
915042651 1:152981861-152981883 CCTGGCGTGCAGAAGCTGCTTGG - Intergenic
915291619 1:154888027-154888049 GCTGGCATGCAGAAGCAGCTGGG - Intergenic
922760050 1:228123011-228123033 GCAGAAATGAAGAAGCTGCAAGG - Intergenic
923128355 1:231053063-231053085 CCTGGGAGGCAGAAGTTGCAGGG - Intergenic
923641938 1:235772147-235772169 CCTGAGAGGCAGAGGTTGCAGGG + Intronic
1063198117 10:3761962-3761984 CCTGACTTGCTGAACCAGCATGG + Intergenic
1063660026 10:8028931-8028953 CCTGAGAGGCAGAGGTTGCAAGG - Intergenic
1065398185 10:25264341-25264363 CCTGACATTTCCAAGCTGCAGGG + Intronic
1065918509 10:30371388-30371410 CCTGGAAGGCAGAGGCTGCAGGG + Intronic
1067165965 10:43866884-43866906 CCTGACAGGCAGAATCAGCGGGG - Intergenic
1067450098 10:46376771-46376793 CCTGACATCCTGAGGCTGCCTGG - Intronic
1067587145 10:47482992-47483014 CCTGACATCCTGAGGCTGCCTGG + Intronic
1067634204 10:47990759-47990781 CCTGACATCCTGAGGCTGCCTGG + Intergenic
1068818373 10:61344495-61344517 CCTGACCTGCAGAAACTGCAAGG - Intergenic
1069250259 10:66258116-66258138 GCTGTCTTGGAGAAGCTGCAGGG - Intronic
1069545612 10:69325908-69325930 CCTGGCAGGCAGAGGTTGCAGGG - Intronic
1069842408 10:71348039-71348061 CCTGCCATGCTGAGGCAGCAGGG + Intronic
1070089248 10:73268767-73268789 CCTGGGAGGCAGAAGTTGCAGGG - Intronic
1070460071 10:76657349-76657371 CCTAACATCCAGAATCTGTAAGG + Intergenic
1071398086 10:85242779-85242801 CCTGTCATGCAGAAACTTGATGG + Intergenic
1072449898 10:95531618-95531640 CGTGGCATGGAGAAGCAGCACGG + Intronic
1072958364 10:99906818-99906840 CCTGACCTACAGAAGCAGCGAGG + Intronic
1073111501 10:101065657-101065679 TCTGGCTTCCAGAAGCTGCAGGG + Intronic
1075493422 10:122895021-122895043 CCTGAGAGGCAGAAGTTGCAGGG - Intergenic
1075670155 10:124258946-124258968 CCTGACCTGCAGAAACTGTGTGG - Intergenic
1076047887 10:127309317-127309339 TCTGATATCCAGAATCTGCAAGG - Intronic
1076590093 10:131576952-131576974 ACTGACACGCAGAAGGCGCATGG + Intergenic
1076867885 10:133177094-133177116 TCTGCCAGGCAGCAGCTGCATGG - Intronic
1078396949 11:10989548-10989570 ACTCAGAGGCAGAAGCTGCAGGG - Intergenic
1079087456 11:17456885-17456907 CCTGACACCCAGGAGATGCACGG - Intronic
1079132497 11:17755661-17755683 CATGAGATGGAGAGGCTGCAGGG + Intronic
1083459497 11:62801367-62801389 CCTGAATCGCAGAAGCTGTATGG - Exonic
1084238432 11:67803208-67803230 CCTGACCTTCAGATGTTGCAGGG + Intergenic
1084457473 11:69276640-69276662 CTTGAGAGGCAGAAGCTGGAGGG - Intergenic
1084542908 11:69798413-69798435 TCTGCCAGGGAGAAGCTGCATGG + Intergenic
1086476296 11:87178499-87178521 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1086766268 11:90699222-90699244 TATTACATGTAGAAGCTGCAGGG - Intergenic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1088303565 11:108384695-108384717 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1090290913 11:125543899-125543921 CCTCAGATGCTGAAGCTCCACGG + Intergenic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1090629503 11:128633766-128633788 CCTGACTTGGAGCACCTGCATGG - Intergenic
1090675064 11:128984297-128984319 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1093107327 12:15104360-15104382 CCTGGGAGGCAGAGGCTGCAGGG - Intergenic
1093141566 12:15516064-15516086 CCTGGGAGGCAGAAGTTGCAGGG - Intronic
1094126479 12:27028317-27028339 CCAGACATGTAGCAGCTTCATGG - Exonic
1095815431 12:46417052-46417074 CCTGGGAAGCAGAAGTTGCAAGG - Intergenic
1096267385 12:50134597-50134619 GATGACATGCAGAAGCTGTAGGG + Exonic
1096716055 12:53492366-53492388 CCTGGCACGCAGAAGGTGCTCGG + Intronic
1096724927 12:53553892-53553914 CCTGACAGGTAGGAGCTGGATGG - Intronic
1097372573 12:58802166-58802188 GTTGACATGCAGAAGCTTAAAGG - Intronic
1098042569 12:66367253-66367275 CATAAGATGCAGAAGCTCCAGGG + Intronic
1098626249 12:72673433-72673455 CGTGACATGCTGAAACTGCCTGG - Intergenic
1098700754 12:73622493-73622515 TCTGATATCCAGAATCTGCAAGG - Intergenic
1100644691 12:96516398-96516420 ACTCAAATGGAGAAGCTGCAGGG + Intronic
1101892047 12:108725909-108725931 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1102215845 12:111160889-111160911 CCTGCCATGGGGAAGATGCAGGG + Intronic
1102243122 12:111337957-111337979 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1103388639 12:120553978-120554000 CCTGAGAGGCAGAAGCTGCAGGG - Intronic
1104207446 12:126653479-126653501 CCTGGGAGGCAGAAGTTGCAGGG - Intergenic
1104462102 12:128964305-128964327 CCTGAGAGGTAGAGGCTGCAAGG + Intronic
1104607125 12:130198342-130198364 CATGAGATGCAGGAGCTGCTGGG + Intergenic
1106164758 13:27233917-27233939 CCTGGGAGGCAGAAGTTGCAGGG + Intergenic
1107185437 13:37513744-37513766 CCTGCCATGCAGAAAGTGTAAGG - Intergenic
1107939554 13:45371794-45371816 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1108171622 13:47747958-47747980 CCTGACAAGGAGAAGCTGGCAGG - Intergenic
1108265775 13:48707245-48707267 GGTGACATGCAGAAGCCGAAAGG - Exonic
1109281480 13:60361429-60361451 CCTGACCTACAGAAACTGAAGGG + Intergenic
1110656247 13:78003572-78003594 GCTAACATGCAGAATCTACAAGG + Intergenic
1112452937 13:99528212-99528234 CATGACAGGGAGAGGCTGCAGGG + Intronic
1113518592 13:110921826-110921848 CCAGCCATGCAGAAGCACCAGGG + Intergenic
1118604332 14:67491904-67491926 CCTGGCATGGGGAAGGTGCATGG + Intronic
1118754260 14:68827225-68827247 CCTGGGAAGCAGAAGTTGCAGGG + Intergenic
1119013348 14:71020651-71020673 TCTGACATCCAGAATCTACAAGG - Intronic
1120224011 14:81769827-81769849 ACTGATATCCAGAAGCTACAGGG + Intergenic
1120484121 14:85088784-85088806 TCTGACATGCAGGGGCTGCGTGG + Intergenic
1121612514 14:95291357-95291379 CCCGAGACGCAGGAGCTGCAGGG - Intronic
1122416248 14:101550991-101551013 CCTGGCAGGCAGAAGTAGCAGGG - Intergenic
1123943119 15:25226118-25226140 GCTGACCTGCAGAAGCCACAAGG - Intergenic
1125006370 15:34822256-34822278 CCTCACATGCTGAAGCGGGATGG - Intergenic
1125706863 15:41745678-41745700 CCTGAGATGTAGAGGCTGCAGGG - Intronic
1126823963 15:52530557-52530579 CACGACATGAAGAAACTGCAAGG - Intergenic
1127055225 15:55124724-55124746 GCTGGGATGCAGAAGATGCAGGG + Intergenic
1128262255 15:66240717-66240739 TCTGCCATGCACTAGCTGCATGG - Intronic
1129787677 15:78320350-78320372 CCTGACTCCGAGAAGCTGCATGG + Intergenic
1130530557 15:84745100-84745122 CCTGACATGCAAAAGACACAGGG + Intergenic
1132329856 15:101004735-101004757 CCTGAACTGCAGAAGGAGCAGGG - Intronic
1133350090 16:5095658-5095680 CCTGACATTCAGATGTCGCAGGG + Intronic
1133419457 16:5633517-5633539 ACTGACATCCAGAATCTACAAGG + Intergenic
1134272710 16:12747354-12747376 CCTGACAGGGTGATGCTGCAGGG + Intronic
1137767805 16:50991401-50991423 GCTGGCAGGCAGAGGCTGCAGGG - Intergenic
1140098845 16:71897086-71897108 CCTGAAAGGTCGAAGCTGCAGGG - Intronic
1140607032 16:76551320-76551342 CCTGGGAGGCAAAAGCTGCAGGG + Intronic
1140881797 16:79205132-79205154 CCTGTCATTTAAAAGCTGCATGG + Intronic
1140895814 16:79323263-79323285 GATGACATGGAGAGGCTGCAGGG + Intergenic
1143131260 17:4678933-4678955 TCTGTCATGCAGAGGCTCCAGGG - Intronic
1143689937 17:8552870-8552892 TCTGAAATGCAGGAGCTGCTGGG - Intronic
1145111036 17:20161868-20161890 CCTGGGAGGCAGAAGTTGCAGGG - Intronic
1146273433 17:31499122-31499144 CCAGAGATGCAGTGGCTGCATGG + Intronic
1147374630 17:40016330-40016352 CCTGACACTCACCAGCTGCAGGG - Exonic
1147952016 17:44112652-44112674 CCTGACTGGCAGAAGCTGGCTGG - Intronic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1148229176 17:45920541-45920563 GCTGCCAGGCAGAAGGTGCACGG - Intronic
1149192971 17:54086040-54086062 CCTGAAATGCTGCAGCTGGATGG + Intergenic
1150123618 17:62622534-62622556 CCTGGCTTGGAGAAGGTGCAGGG + Intergenic
1150322705 17:64229859-64229881 CCTCACATTGAGAAGCTGAATGG - Intronic
1150967746 17:69990834-69990856 ACTGAAATGAAGAAGCTTCAAGG - Intergenic
1151256339 17:72879701-72879723 CCTGTCACTCAGCAGCTGCAGGG - Intronic
1151635710 17:75346418-75346440 CCTGGGAGGCAGAAGTTGCAGGG + Intronic
1151880280 17:76890577-76890599 CCTGAGAGGCAGAGGCTGCAGGG - Intronic
1152255663 17:79238010-79238032 CCTGAGAGGCAGAGGTTGCAGGG - Intronic
1152914059 17:83023766-83023788 CCCGACCTCCAGCAGCTGCAGGG + Intronic
1153811456 18:8755574-8755596 CCTGGAACTCAGAAGCTGCATGG - Intronic
1155091246 18:22514049-22514071 CCTAATATGCAGAATCTACAAGG - Intergenic
1155402780 18:25457370-25457392 AATGACATGCAGAAGGAGCAGGG + Intergenic
1155661565 18:28254574-28254596 CCTAATATGCAGAATCTACAAGG + Intergenic
1155797467 18:30058302-30058324 CCTGACAAGCAGATGCTTCTAGG - Intergenic
1156279018 18:35614736-35614758 ACTAACATCCAGAATCTGCAAGG + Intronic
1162222753 19:9192127-9192149 TCTGCCATGCAGCTGCTGCAGGG - Intergenic
1162967080 19:14161115-14161137 CCCCACCTGCAGAACCTGCAGGG - Intronic
1163079425 19:14926589-14926611 CCTGAGAGGCAGAGGTTGCAGGG - Intergenic
1163168540 19:15514593-15514615 CCTGGGAGGCAGAAGTTGCAGGG + Intronic
1163221445 19:15924427-15924449 CCTGTCATGTAGACGCTACATGG - Intronic
1163297709 19:16422880-16422902 CCTGGGAGGCAGAAGTTGCAGGG + Intronic
1163410313 19:17149871-17149893 CCAGACCTGCAGATGCAGCACGG + Intronic
1165681100 19:37776746-37776768 ACTGACATCCAGAATCTACAAGG + Intronic
1165731272 19:38147135-38147157 CCTGGGAGGCAGAAGTTGCAGGG - Intronic
1167810843 19:51828883-51828905 CCTGCCCTCCAGGAGCTGCAGGG - Intergenic
1167926448 19:52825019-52825041 CCTGAAATGCAGAGGCTGCAGGG + Intronic
1168404177 19:56102360-56102382 CCTGACATGCAGACACAGCAAGG + Intronic
925857901 2:8148366-8148388 CCTGACTTACAGAAGCAGAAAGG + Intergenic
926890252 2:17633441-17633463 CCTGAGAGGCAGAGGTTGCAGGG + Intronic
926931162 2:18042540-18042562 CCTGACATTCAGCAGCAGCTGGG - Intronic
927370162 2:22345115-22345137 CCTGAGAGGCAGAAGTTGCGAGG + Intergenic
928245198 2:29620588-29620610 TCTGCCATTCAGCAGCTGCATGG + Intronic
930261430 2:49151246-49151268 TCTGCCATCCAGGAGCTGCAGGG + Intronic
930716931 2:54602091-54602113 CCTGACTAGCAGAAGCTTCCTGG - Intronic
930889362 2:56365034-56365056 CATGACATGCAGGAGTTGCATGG - Intronic
932633968 2:73371730-73371752 CCTGCCCTGCAGAGGTTGCAAGG - Intergenic
933379583 2:81525899-81525921 CCTGACCAGCAGAACCTACAGGG - Intergenic
933818034 2:86084339-86084361 CCTGAGAGGCAGAGGCTGTAGGG + Intronic
935274294 2:101463105-101463127 CCTGTCATACAGAGGCTGCAAGG - Intronic
935361845 2:102251770-102251792 CCAGACATGCAGGAGAGGCAAGG - Intergenic
935373331 2:102370161-102370183 CCTGCCATCCAGGAGCTCCAAGG - Intronic
935712534 2:105912116-105912138 CCTGAAAACCAGAAGCTCCAAGG - Intergenic
936289595 2:111211309-111211331 CCTGGGATGCAGAGGTTGCAGGG - Intergenic
937344322 2:121114979-121115001 CCTGGGAGGCAGAAGTTGCAGGG - Intergenic
937380309 2:121370697-121370719 TCTGACATGCAGCATCTTCATGG + Intronic
937638062 2:124179233-124179255 CCTGGGAGGCAGAAGTTGCAGGG - Intronic
938088447 2:128417093-128417115 ACTGACGTCCAGAAGCTGCGTGG + Intergenic
938548115 2:132353247-132353269 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
939982678 2:148799715-148799737 CCTGAGAGGCAGAGGTTGCAGGG - Intergenic
941651962 2:168101660-168101682 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
942846264 2:180429370-180429392 CCTAACATGTAGAAGCAACATGG - Intergenic
943029052 2:182665330-182665352 CCTAATATTCAGAAGCTACAAGG + Intergenic
943600422 2:189912463-189912485 CCTGAGAGGCAGAGGCTGCAGGG + Intronic
944294625 2:198048541-198048563 CCAGTCATGCAGAAGGTGAAGGG + Intronic
945110127 2:206354948-206354970 CCTGAGAGGCAGAGGTTGCAGGG - Intergenic
945194375 2:207224596-207224618 CCTGAGATCCAGAAACTGCTTGG + Intergenic
947504359 2:230695531-230695553 CCTGTGAGGCAGAGGCTGCAGGG + Intergenic
947672990 2:231952205-231952227 CCTGGGAGGCAGAAGTTGCAGGG + Intergenic
947686826 2:232094641-232094663 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
947714815 2:232334152-232334174 CCGGTGCTGCAGAAGCTGCATGG + Intronic
948182124 2:235990334-235990356 CCTGACCCACAGAGGCTGCAGGG - Intronic
948510119 2:238458413-238458435 CCTGAAGTGCAGAAGCTGGTGGG + Intergenic
1169491734 20:6076861-6076883 TCTGACTTGCAGAACCTGCCAGG - Exonic
1170490811 20:16872145-16872167 CCTAACATCCAGAATCTACAAGG - Intergenic
1170822724 20:19767847-19767869 CCTGAGAGGCAGAGGTTGCAGGG + Intergenic
1170873239 20:20227532-20227554 ACTTCCCTGCAGAAGCTGCAAGG - Intronic
1171876984 20:30586019-30586041 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
1175371690 20:58496754-58496776 TGTTACAGGCAGAAGCTGCAAGG + Intronic
1175563522 20:59953859-59953881 CATGGCAGGCAGAAGCTGGAAGG - Intergenic
1175802356 20:61808078-61808100 CCTGCCACACAGAAGCAGCATGG + Intronic
1176377672 21:6094484-6094506 CGCCACATGAAGAAGCTGCAGGG + Intergenic
1177320490 21:19513679-19513701 CCTGCCATCCAGAAGCTTCCTGG - Intergenic
1179745802 21:43443760-43443782 CGCCACATGAAGAAGCTGCAGGG - Intergenic
1181470629 22:23137165-23137187 CCAGAGAGGCAGAGGCTGCAGGG - Intronic
1181620601 22:24088530-24088552 CCTGAGAGGCAGAGGTTGCAGGG + Intronic
1184146921 22:42617197-42617219 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1184245424 22:43233416-43233438 CCTGACTTGCAGAAGCAAAAAGG + Intronic
1184358398 22:43997714-43997736 CATTACCTGCAGAAGCTGCAGGG + Intronic
1184595999 22:45514643-45514665 CTTGACATGCAAAGGCTGCTGGG - Intronic
1184974478 22:48051383-48051405 CCTGGGAGGCAGAAGTTGCAGGG + Intergenic
949109403 3:240478-240500 ACTGACATCCAGAATCTACAAGG - Intronic
950462576 3:13134226-13134248 CCAGATATGCAGGGGCTGCAGGG + Intergenic
951246683 3:20349575-20349597 CAATACATGCAGAAGCTGGATGG + Intergenic
952271211 3:31833458-31833480 CCTGACATGCAGAAGCTGCATGG + Intronic
953849013 3:46450915-46450937 CCTGCCAGGCAGCAGCTGCACGG - Intronic
953853248 3:46481673-46481695 CCTGAAAGGCAGAGGTTGCAGGG + Intronic
954318385 3:49813609-49813631 CCTGCCATGCAGAGGATTCAGGG - Exonic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954655363 3:52191137-52191159 CCTGATATGGAGAAGGAGCATGG - Intergenic
960517605 3:118619283-118619305 CTTCACATGCAGTTGCTGCAGGG - Intergenic
960866928 3:122211350-122211372 CCTGATATCCAGAATCTACAAGG + Intronic
960954833 3:123024967-123024989 CCTGACATGGACAATCTCCAGGG + Intronic
962025461 3:131542642-131542664 AGTGACATGCAGATGCTGGACGG - Exonic
963948108 3:151168779-151168801 CCTGAGAGGCAGAGGTTGCAGGG - Intronic
964574937 3:158155508-158155530 CCTGAGAGGTAGAGGCTGCAGGG - Intronic
967884058 3:194321491-194321513 CCTGGGATGCAGAGGTTGCAGGG + Intergenic
968597298 4:1492018-1492040 CCCGACAGGCAGAAGCAGCCTGG + Intergenic
968997195 4:3953317-3953339 CCTGACATTCAGATGCCGCAGGG + Intergenic
969601613 4:8179735-8179757 CCTGACCTGCAGAGGGTCCATGG + Intergenic
969970545 4:11043147-11043169 ACTAACATCCAGAATCTGCAAGG - Intergenic
972757535 4:42063835-42063857 CATGAGATGCAGAAGCTGAGAGG - Intronic
975639934 4:76490359-76490381 TCTGACATGCAGAAAAGGCAGGG + Intronic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
977888671 4:102281374-102281396 CATGACAGGCAGCTGCTGCACGG - Intronic
978010482 4:103676161-103676183 CCTGTGAGCCAGAAGCTGCAAGG - Intronic
979107437 4:116705674-116705696 CCTTCCTTGCAGAGGCTGCAGGG - Intergenic
982306208 4:153933858-153933880 CCTCACATCCAGAAGCAGCTGGG - Intergenic
985217257 4:187667164-187667186 CCTGCCACTCAGAGGCTGCAAGG + Intergenic
985361451 4:189179789-189179811 CCTGACATGCAGATTCTTCCTGG + Intergenic
985988937 5:3539185-3539207 CCTGAAATGCAGATGCCTCAAGG + Intergenic
988087138 5:26486783-26486805 CCTTACATTCCTAAGCTGCAGGG - Intergenic
988894675 5:35659086-35659108 CCGAACATGCATGAGCTGCACGG - Exonic
993225114 5:85159777-85159799 CCAGACAAGCAGAAGCAGTAAGG - Intergenic
993256971 5:85604424-85604446 CCTGCCATGTAGCTGCTGCAGGG - Intergenic
993544266 5:89191617-89191639 CCTGAAATGAAACAGCTGCAAGG - Intergenic
993562188 5:89423857-89423879 ACTGACATCCAGAATCTACAAGG + Intergenic
994546917 5:101178347-101178369 CCTGACATGGAGTAGCTGGAGGG + Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
995781930 5:115785888-115785910 CCTGACATTCAGAGACTGCCGGG - Intergenic
996147758 5:119996389-119996411 CCTTACTTGAAGATGCTGCAAGG - Intergenic
997325855 5:133020366-133020388 CCTGGGAGGCAGAGGCTGCAAGG + Intronic
997843477 5:137264065-137264087 CACGACAATCAGAAGCTGCATGG + Intronic
998068287 5:139176660-139176682 CCTCACATGCAGAAGAGGCAAGG + Intronic
999189207 5:149733644-149733666 CCTGCCAAGCAGAAGCTCCCAGG + Intronic
999207067 5:149856692-149856714 CCTGATTTGCAGAAGCAGTATGG + Intergenic
1000072963 5:157758188-157758210 CCTGGGAGGCAGAAGTTGCAGGG - Exonic
1001146766 5:169191845-169191867 CCTGACATGCTGCAGCAGCTGGG + Intronic
1001287018 5:170431218-170431240 CCTGACAGGCAGTGGCAGCAAGG - Intronic
1001625153 5:173126214-173126236 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1001919798 5:175590912-175590934 CCTTTCATGCAGAGGCTGCTAGG - Intergenic
1001943288 5:175755881-175755903 CCTGGGAAGCAGAGGCTGCAGGG + Intergenic
1004547921 6:16616462-16616484 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1006373430 6:33659061-33659083 GCTGGCATGCAGAGGCTGCCCGG - Exonic
1007130642 6:39470362-39470384 CGTCACAGGCAGGAGCTGCAAGG - Intronic
1007257959 6:40541741-40541763 TCTCACTTGCAGAAGATGCAGGG + Intronic
1008410130 6:51167826-51167848 CCTTACATTCTGCAGCTGCAGGG - Intergenic
1009494659 6:64332183-64332205 CCTGACATGGAGAAGGACCACGG - Intronic
1009645563 6:66396334-66396356 CATGACATGAAGTAGCAGCAGGG + Intergenic
1010372385 6:75125955-75125977 GCTGTCATGAATAAGCTGCATGG + Intronic
1010882096 6:81189964-81189986 CCTGACATCCAGAATTTCCAAGG + Intergenic
1012373786 6:98537170-98537192 CCTGGGAGGCAGAAGTTGCAGGG + Intergenic
1014035083 6:116757671-116757693 CCTGGCAGGCAGAGGATGCAGGG + Intronic
1016901123 6:149103410-149103432 GCTAACATCCAGAATCTGCAAGG + Intergenic
1016948355 6:149555580-149555602 ACTGATATCCAGAATCTGCAAGG + Intergenic
1019028835 6:168993426-168993448 CCCAACAGGCAGAGGCTGCAGGG - Intergenic
1019366327 7:635280-635302 CCTGAGATGTGGAAGCTGCCAGG - Intronic
1019558884 7:1646103-1646125 CCTGGGAGGCAGAGGCTGCAGGG - Intergenic
1020166973 7:5814922-5814944 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1021568478 7:22038717-22038739 CCTGAAAAGCAGAAGCTGCAGGG - Intergenic
1022021468 7:26403448-26403470 CCTGGGAGGCAGAAGTTGCAGGG - Intergenic
1024056387 7:45662233-45662255 CCTGCCATGCTGGAGCTGCCAGG + Intronic
1024084927 7:45884989-45885011 CTTGAGATGGAGAAGCTGGAAGG + Intergenic
1025957037 7:66190980-66191002 CCTGAGAAGCAGAGGTTGCAGGG - Intergenic
1026329595 7:69340152-69340174 CCCAACAGGCAAAAGCTGCAGGG - Intergenic
1026615737 7:71902032-71902054 CCTGATATCCAGAATCTACAGGG + Intronic
1029221586 7:98994812-98994834 CCTGTCTTTCAGAAGCTGAAAGG + Exonic
1030380908 7:108810965-108810987 CCTGGCAAGCAGAAGCAGCTGGG - Intergenic
1031149558 7:118037275-118037297 CCTGGGATGCATAATCTGCAGGG + Intergenic
1032465017 7:132138738-132138760 TGTGACCTGCAGCAGCTGCATGG + Intronic
1033690362 7:143730481-143730503 TCTGATATCCAGAATCTGCAAGG - Intergenic
1033820576 7:145129881-145129903 CCTGGCATGAAGAGGCTGCTGGG + Intergenic
1034057291 7:148048544-148048566 CCTGACATGCCCCAGCTCCATGG - Intronic
1034743481 7:153500255-153500277 ACTGATATCCAGAATCTGCAAGG - Intergenic
1034876918 7:154732903-154732925 CCTGACAAGGAGTAGCTGCTGGG + Intronic
1035872649 8:3152819-3152841 CCGCACATTCAGCAGCTGCATGG - Intronic
1037379290 8:18267069-18267091 CCTGACTTACAGAAATTGCAAGG + Intergenic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1039704080 8:39989546-39989568 CCTGACAGCCAGAAGCTCCCTGG - Intronic
1041952863 8:63523976-63523998 GCTGACATGCAGTAGGTGCTTGG - Intergenic
1045300623 8:100907524-100907546 CCTCACATGCAGCAGGTGCCTGG - Intergenic
1046721484 8:117624397-117624419 ACTGACATAGTGAAGCTGCAAGG - Intergenic
1047681071 8:127254580-127254602 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1047776022 8:128071173-128071195 TCTGTCACGCAGAACCTGCATGG - Intergenic
1049067637 8:140330001-140330023 CCTGGGAGGCAGAAGTTGCAGGG + Intronic
1049251085 8:141589315-141589337 CCAGACTTGCAGAAGCTGGTGGG + Intergenic
1049322086 8:142001964-142001986 CCCGCGTTGCAGAAGCTGCAGGG - Intergenic
1049483960 8:142841759-142841781 CCTAACCTGCAGAAGATGTATGG + Intronic
1049540851 8:143208138-143208160 CCTGATGTGCAGAGGCTGCCAGG + Intergenic
1050575007 9:6985764-6985786 CCTGAGAGGCAGAGGTTGCAGGG - Intronic
1052096764 9:24392637-24392659 GCTGGTATGCAGAATCTGCAAGG + Intergenic
1052260661 9:26512840-26512862 CCTAACATGCACAACCAGCATGG + Intergenic
1052512328 9:29437818-29437840 ACTGACAAAGAGAAGCTGCAGGG - Intergenic
1052572792 9:30249725-30249747 CCTGACATTCAGAAGCTAACTGG - Intergenic
1052580454 9:30348719-30348741 ACTAACATGCAGAATCTACAGGG + Intergenic
1052836997 9:33258218-33258240 CCTGGCAGGCAGAGGCTACAGGG + Intronic
1052872640 9:33523669-33523691 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
1053752320 9:41269184-41269206 TCTGCCCTGCAGCAGCTGCACGG - Intergenic
1053752770 9:41273441-41273463 TCTGCCCTGCAGCAGCTGCACGG - Intergenic
1054257847 9:62833516-62833538 TCTGCCCTGCAGCAGCTGCACGG - Intergenic
1054258295 9:62837793-62837815 TCTGCCCTGCAGCAGCTGCACGG - Intergenic
1054333475 9:63782248-63782270 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
1054351584 9:64021294-64021316 TCTGTCCTGCAGCAGCTGCACGG + Intergenic
1056266534 9:84902118-84902140 CCTGGGAGTCAGAAGCTGCAGGG + Intronic
1056803968 9:89713619-89713641 CCTGACTTGCAGAAACTGGGTGG - Intergenic
1059529487 9:115022950-115022972 CCTGACATGCAGCAGGTGTTGGG - Intronic
1059602009 9:115788932-115788954 ACAGACATGCTAAAGCTGCATGG - Intergenic
1060225189 9:121786152-121786174 CCTGAGATGCTGAAGATGCAGGG - Intergenic
1061364294 9:130163388-130163410 CCTGGGAAGCAGAGGCTGCAGGG - Intergenic
1062568787 9:137175021-137175043 ATTGACCTGCAGGAGCTGCAGGG - Exonic
1202800478 9_KI270719v1_random:170582-170604 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
1202800924 9_KI270719v1_random:174864-174886 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
1185921119 X:4093958-4093980 CCTGACAGGCAAAGGTTGCAGGG + Intergenic
1185972707 X:4682297-4682319 CCTGGGAGGCAGAGGCTGCACGG + Intergenic
1186709034 X:12173599-12173621 CCTGACAGGTAGAATATGCAGGG + Intronic
1187168141 X:16824108-16824130 CCTGAAGTGCAGATGCTACAGGG - Intronic
1188030660 X:25260032-25260054 CCTGGCCTTCAGAAACTGCATGG - Intergenic
1188923311 X:36007147-36007169 CCTCACATTCAAAAACTGCAGGG - Intergenic
1189982211 X:46522143-46522165 TCTGACAAGCAGAAGTGGCACGG + Intronic
1192043030 X:67643361-67643383 TCTCACATGTGGAAGCTGCAAGG + Exonic
1194358779 X:92920612-92920634 CATACCATGCTGAAGCTGCAGGG + Intergenic
1194886645 X:99323658-99323680 CCTAACATCCAGAATCTACAAGG + Intergenic
1197133778 X:123037000-123037022 CCTGCCAAGCAGAAAATGCAGGG - Intergenic
1198490437 X:137134723-137134745 GCTGATATCCAGAATCTGCAAGG + Intergenic
1199282646 X:146020795-146020817 CCTGTCTTGCAGAATTTGCAGGG - Intergenic
1199686783 X:150272187-150272209 CCAGACATGGAGAAGCAGAATGG + Intergenic
1200666945 Y:6036306-6036328 CATACCATGCTGAAGCTGCAGGG + Intergenic
1201221994 Y:11781171-11781193 CAAGACATGAAGACGCTGCATGG - Intergenic
1201784875 Y:17764286-17764308 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1201816677 Y:18141701-18141723 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1202344692 Y:23909107-23909129 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1202526076 Y:25760976-25760998 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic