ID: 952273995

View in Genome Browser
Species Human (GRCh38)
Location 3:31859614-31859636
Sequence CTTCTTGCTGTGGCATCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3691
Summary {0: 2, 1: 72, 2: 233, 3: 1047, 4: 2337}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952273995_952273998 -5 Left 952273995 3:31859614-31859636 CCATGGGATGCCACAGCAAGAAG 0: 2
1: 72
2: 233
3: 1047
4: 2337
Right 952273998 3:31859632-31859654 AGAAGGTCCTCACCAGATGCTGG 0: 9
1: 85
2: 193
3: 378
4: 634
952273995_952274001 9 Left 952273995 3:31859614-31859636 CCATGGGATGCCACAGCAAGAAG 0: 2
1: 72
2: 233
3: 1047
4: 2337
Right 952274001 3:31859646-31859668 AGATGCTGGTCCCTCAATCTTGG 0: 1
1: 11
2: 38
3: 157
4: 470
952273995_952274004 22 Left 952273995 3:31859614-31859636 CCATGGGATGCCACAGCAAGAAG 0: 2
1: 72
2: 233
3: 1047
4: 2337
Right 952274004 3:31859659-31859681 TCAATCTTGGACTTCCATCAAGG 0: 1
1: 0
2: 0
3: 12
4: 117
952273995_952274005 23 Left 952273995 3:31859614-31859636 CCATGGGATGCCACAGCAAGAAG 0: 2
1: 72
2: 233
3: 1047
4: 2337
Right 952274005 3:31859660-31859682 CAATCTTGGACTTCCATCAAGGG 0: 1
1: 0
2: 1
3: 12
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952273995 Original CRISPR CTTCTTGCTGTGGCATCCCA TGG (reversed) Intronic
Too many off-targets to display for this crispr