ID: 952275020

View in Genome Browser
Species Human (GRCh38)
Location 3:31868401-31868423
Sequence CTTCAAAACCCGATGGAGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 67}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952275020_952275024 10 Left 952275020 3:31868401-31868423 CCGAGCTCCATCGGGTTTTGAAG 0: 1
1: 0
2: 0
3: 1
4: 67
Right 952275024 3:31868434-31868456 CACCTCCCCCGCCATTGTCTAGG 0: 1
1: 0
2: 0
3: 9
4: 155
952275020_952275026 13 Left 952275020 3:31868401-31868423 CCGAGCTCCATCGGGTTTTGAAG 0: 1
1: 0
2: 0
3: 1
4: 67
Right 952275026 3:31868437-31868459 CTCCCCCGCCATTGTCTAGGTGG 0: 1
1: 0
2: 0
3: 13
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952275020 Original CRISPR CTTCAAAACCCGATGGAGCT CGG (reversed) Intronic
902118568 1:14142132-14142154 CCTTAAAACCAGATGGAGGTAGG + Intergenic
905834410 1:41105069-41105091 CTTCAATATCCGAAGTAGCTGGG + Intronic
906232039 1:44172249-44172271 CTTCAGAACCCGACAGACCTGGG - Intergenic
906672136 1:47664120-47664142 TTTCAAAACCAGAGGGAGATAGG - Intergenic
1068791833 10:61037720-61037742 CTTAAAAACCCTATTGAACTTGG - Intergenic
1073277835 10:102328085-102328107 CGTCAAAAATAGATGGAGCTAGG - Intronic
1075384326 10:122044124-122044146 CTTCGAAGCCCGAGAGAGCTGGG - Intronic
1079453896 11:20620748-20620770 CTTCAAAGCCAGATAGACCTGGG - Intronic
1080797811 11:35581818-35581840 ATTCAAAACGGGATGGTGCTTGG + Intergenic
1082989651 11:59196497-59196519 CTTCAAAGTCCAATGGACCTGGG + Intronic
1084320832 11:68372629-68372651 CCTCCAAACCCCATGGAGCGGGG - Intronic
1084326706 11:68404475-68404497 CTTTAAAATACGAGGGAGCTGGG + Intronic
1085127515 11:74011672-74011694 CCTCACAACCCCATGAAGCTGGG + Intergenic
1088709233 11:112491741-112491763 TTTCAAACCCCGATGGAGGCAGG + Intergenic
1090457770 11:126864780-126864802 CCTCTAAAGCTGATGGAGCTAGG + Intronic
1094350271 12:29516487-29516509 CTACAAAACCACATGGACCTTGG + Intronic
1096541657 12:52311215-52311237 CTCCAAAAGCTGAAGGAGCTTGG - Intergenic
1100961956 12:99972540-99972562 CATCAAGAGCTGATGGAGCTGGG + Intronic
1105592882 13:21810925-21810947 CTTCAAAACCCGAGGAGCCTTGG + Intergenic
1107631175 13:42344138-42344160 CTCCAAAACTCAATGGACCTGGG - Intergenic
1114310064 14:21458284-21458306 CTTCAAAAACCAATGGACATTGG + Intergenic
1117741285 14:58821732-58821754 CATCAGAACCAGATGGAACTGGG - Intergenic
1120017198 14:79487508-79487530 ACTCAAAACCCTATGCAGCTGGG + Intronic
1121393786 14:93599904-93599926 CATTAAAACCAGATGCAGCTGGG + Intronic
1127315864 15:57793033-57793055 CTTCAAGACCTGTTGGAACTCGG + Intergenic
1134769229 16:16791723-16791745 CTTCAAATTCAGATGGACCTGGG - Intergenic
1146765917 17:35521562-35521584 CATCAAAACCCAATTGAGCCTGG + Intronic
1151913945 17:77103817-77103839 CCTCATAACCCCATGGAGCCGGG - Intronic
1152569187 17:81114078-81114100 CTTCAGCCCCCCATGGAGCTGGG + Intronic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1158666387 18:59436586-59436608 CTACAAAACCCTATGAAGTTGGG - Intronic
1163258172 19:16170358-16170380 CTTCTAAAGCAGATGGAGTTGGG + Intronic
1164144396 19:22502677-22502699 GCTCAAAACAAGATGGAGCTTGG - Intronic
929007582 2:37410927-37410949 CTTAAAAACCCAATGGAGGCTGG + Intergenic
929721372 2:44372061-44372083 CTTTAACAACCTATGGAGCTAGG - Intronic
944522110 2:200582320-200582342 ATTCACAACCCTATGGGGCTAGG + Intronic
945005583 2:205401827-205401849 CTTCACAACTAAATGGAGCTTGG + Intronic
946036269 2:216744858-216744880 CTTGAAGACCCCATAGAGCTGGG + Intergenic
1169055909 20:2620833-2620855 CTTTAAAACTTAATGGAGCTTGG + Intronic
1180082070 21:45491497-45491519 CTCCAACACCACATGGAGCTGGG - Intronic
1181801984 22:25353778-25353800 CTTTAAAATACGAGGGAGCTGGG - Intronic
1183667282 22:39253250-39253272 CATCAAAACAGGAAGGAGCTGGG - Intergenic
1184419362 22:44370553-44370575 CTTCCACACCCGATGGGGCCTGG - Intergenic
952275020 3:31868401-31868423 CTTCAAAACCCGATGGAGCTCGG - Intronic
952922231 3:38293433-38293455 CTTAAAAACCCTATTGAACTTGG - Intronic
956526554 3:70169382-70169404 CTTCAAAACTTTATGGATCTAGG + Intergenic
983667022 4:170193791-170193813 CTTAAAAACCCTATTGAACTTGG - Intergenic
985995135 5:3593510-3593532 CCTCAAAACACCAGGGAGCTGGG - Intergenic
991297855 5:65100829-65100851 CTTCAAAAGGAGATGGAGGTGGG - Intergenic
991484740 5:67123220-67123242 CCTCAAAAACTGGTGGAGCTGGG + Intronic
994117434 5:96076447-96076469 CTTCATAACCCTAAGGGGCTCGG + Intergenic
996377136 5:122822948-122822970 CTTCAGAACTCCATGAAGCTGGG + Intronic
999614146 5:153404538-153404560 CTTCAAGACCCAAAGGAGCTAGG + Intergenic
1002070388 5:176675945-176675967 CTTCAAAAGCAGGTGGGGCTAGG + Intergenic
1002114558 5:176948739-176948761 ATTCAAAACATGGTGGAGCTGGG + Intronic
1006799899 6:36753096-36753118 CTTCAAAACAAAAGGGAGCTTGG + Intronic
1011602095 6:89069481-89069503 CTTTCAAGCCCGATGAAGCTGGG - Intergenic
1013244431 6:108273401-108273423 CTTCAAAACCTGGTTGAGCATGG + Intergenic
1013351327 6:109308649-109308671 CTTCAAAACAATATGGAGGTGGG + Intergenic
1017641065 6:156494449-156494471 CTCCCCAACCCAATGGAGCTAGG + Intergenic
1021111135 7:16696033-16696055 CTTCAAAAGCAGAAGGAGCCGGG - Intronic
1028124708 7:87099388-87099410 CTTCAAAACCAGCTGAGGCTAGG - Intergenic
1028692516 7:93669538-93669560 CTTTATAACCTTATGGAGCTGGG - Intronic
1041117488 8:54554359-54554381 CTTCAAATCCCTTTGAAGCTGGG - Intergenic
1041567018 8:59290183-59290205 CTTCAAAACTCTATGGGGCAAGG + Intergenic
1044402696 8:91790952-91790974 CTTCAAAAACCAATGAATCTAGG + Intergenic
1046952779 8:120033949-120033971 CTTCAGCCCCCGGTGGAGCTGGG - Intronic
1193039589 X:76990520-76990542 CTTCAAAAATCAATGGATCTAGG + Intergenic
1194649415 X:96497811-96497833 CTCCAAAATCCTATGGACCTGGG - Intergenic