ID: 952275024

View in Genome Browser
Species Human (GRCh38)
Location 3:31868434-31868456
Sequence CACCTCCCCCGCCATTGTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 155}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952275018_952275024 12 Left 952275018 3:31868399-31868421 CCCCGAGCTCCATCGGGTTTTGA 0: 1
1: 0
2: 0
3: 3
4: 31
Right 952275024 3:31868434-31868456 CACCTCCCCCGCCATTGTCTAGG 0: 1
1: 0
2: 0
3: 9
4: 155
952275015_952275024 25 Left 952275015 3:31868386-31868408 CCAAAAAGGCAATCCCCGAGCTC 0: 1
1: 0
2: 0
3: 8
4: 73
Right 952275024 3:31868434-31868456 CACCTCCCCCGCCATTGTCTAGG 0: 1
1: 0
2: 0
3: 9
4: 155
952275020_952275024 10 Left 952275020 3:31868401-31868423 CCGAGCTCCATCGGGTTTTGAAG 0: 1
1: 0
2: 0
3: 1
4: 67
Right 952275024 3:31868434-31868456 CACCTCCCCCGCCATTGTCTAGG 0: 1
1: 0
2: 0
3: 9
4: 155
952275019_952275024 11 Left 952275019 3:31868400-31868422 CCCGAGCTCCATCGGGTTTTGAA 0: 1
1: 0
2: 0
3: 1
4: 63
Right 952275024 3:31868434-31868456 CACCTCCCCCGCCATTGTCTAGG 0: 1
1: 0
2: 0
3: 9
4: 155
952275021_952275024 3 Left 952275021 3:31868408-31868430 CCATCGGGTTTTGAAGCACCACA 0: 1
1: 0
2: 0
3: 13
4: 51
Right 952275024 3:31868434-31868456 CACCTCCCCCGCCATTGTCTAGG 0: 1
1: 0
2: 0
3: 9
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952275024 Original CRISPR CACCTCCCCCGCCATTGTCT AGG Intronic
902810516 1:18885470-18885492 CACCTGTCCCACCATGGTCTTGG + Exonic
903275583 1:22219294-22219316 CATCTCCCTGGCCACTGTCTGGG + Intergenic
904875174 1:33649230-33649252 CTCCTGCCCAGCCATGGTCTGGG + Intronic
906286507 1:44591305-44591327 CACCTTGCACACCATTGTCTTGG - Intronic
906507875 1:46393643-46393665 CACCTTCCCCTCCCTTGTCCAGG - Intergenic
907274418 1:53309452-53309474 CACCTCCCCTCTCAGTGTCTTGG - Intronic
910030011 1:82708406-82708428 CCTCTCCCCCCCAATTGTCTGGG + Intergenic
911668170 1:100578340-100578362 CGCCTCCTCAGCCATTGTTTGGG + Intergenic
911834956 1:102606169-102606191 CACATCCACTGGCATTGTCTTGG + Intergenic
912176521 1:107164887-107164909 CCCCTTCCCCTCCCTTGTCTAGG - Intronic
914995629 1:152541118-152541140 CACTTCCTCCTCCATTGTATTGG - Intronic
1065637496 10:27745819-27745841 CACCGCCACCGCCGTCGTCTCGG + Exonic
1070112691 10:73500161-73500183 CACCTTCCCCACAATTGTCTGGG + Intronic
1073056964 10:100709356-100709378 CCCCTTCTCTGCCATTGTCTTGG - Intergenic
1075693761 10:124418796-124418818 CGCCTCCCCCGCCGCTGTCAGGG + Intronic
1076527985 10:131124372-131124394 CCCCACCCCAGCCTTTGTCTTGG + Intronic
1077298681 11:1837586-1837608 CCCCTCCCCCGTCCTTGTCAGGG - Intergenic
1077484803 11:2833770-2833792 CACCTTCCCCACTGTTGTCTCGG - Intronic
1079173819 11:18120816-18120838 CACCTCCCCAGCCGCTGCCTTGG + Intronic
1080550401 11:33369410-33369432 CACCTCCACTGCTACTGTCTTGG - Intergenic
1081701657 11:45156316-45156338 AACCTTCCCATCCATTGTCTGGG + Intronic
1082709959 11:56542615-56542637 CAGCTCCCTCACCATCGTCTTGG - Exonic
1083171078 11:60924461-60924483 CTGCTCCCGCTCCATTGTCTGGG + Exonic
1083853708 11:65381937-65381959 TTCCTCCACCGGCATTGTCTGGG + Exonic
1083896069 11:65620446-65620468 GGCCTCCCAAGCCATTGTCTTGG + Intronic
1084040061 11:66537401-66537423 CACCTCACCCTCCATGGTCCTGG + Intronic
1084302928 11:68263026-68263048 CACCTCCCCCGACTCTGGCTGGG - Intronic
1084325168 11:68396067-68396089 CACTGTCCCCGCCATTGCCTGGG - Intronic
1088933900 11:114379467-114379489 CACATCCCCCGCCCCTGCCTTGG + Intergenic
1089763723 11:120748117-120748139 CAACTCCCCAGCCAAGGTCTTGG - Intronic
1096214728 12:49792787-49792809 CACCTCCCGCTCCAGTGTGTGGG + Exonic
1101210982 12:102534879-102534901 CACCCCACGCTCCATTGTCTGGG + Intergenic
1102011278 12:109620018-109620040 CACCTCTACCCCCATTATCTGGG - Intergenic
1103046935 12:117743922-117743944 CACCTCCCCAGACATCATCTTGG - Intronic
1103893145 12:124254852-124254874 CAGCTGCCCCGCCCTTCTCTGGG - Intronic
1105028760 12:132868412-132868434 CGCCTCCCACGCCATTCTCCTGG - Intronic
1119614834 14:76092129-76092151 CACCTGCCCCGGCAAGGTCTGGG - Intergenic
1120978086 14:90267024-90267046 CACCTACCCAGCCCTTGTCAAGG + Intronic
1121224499 14:92311338-92311360 CACCTCCCACCCCATGGTCATGG + Intergenic
1122898698 14:104773136-104773158 CACCTCCCCCGGCAGTGTCCCGG - Intronic
1123067271 14:105625035-105625057 CTCCTCCCGCGGCTTTGTCTTGG + Intergenic
1123076250 14:105668802-105668824 CTCCTCCCACGGCTTTGTCTTGG + Intergenic
1123090951 14:105742032-105742054 CTCCTCCCGCGGCTTTGTCTTGG + Intergenic
1123096588 14:105769796-105769818 CTCCTCCCGCGGCTTTGTCTTGG + Intergenic
1125599513 15:40907562-40907584 CCCCTCCCCCACCATTGTTCTGG + Intergenic
1126134247 15:45375759-45375781 CACCACCCCCCGCATTGTTTAGG - Intronic
1126454297 15:48844406-48844428 CTCCTCCCCAGCCTCTGTCTGGG + Intronic
1127539049 15:59919231-59919253 CACCTCTCACTGCATTGTCTCGG + Intergenic
1127853517 15:62935716-62935738 AACCTGCCCAGCCATAGTCTTGG + Intergenic
1130018032 15:80202245-80202267 CACCTCCCCTGCCCCAGTCTGGG - Intergenic
1131343691 15:91626936-91626958 CCCCACCCCTGCCCTTGTCTCGG + Intergenic
1131848249 15:96510847-96510869 CACATCCCCCTCCATTTCCTTGG - Intergenic
1132931060 16:2459521-2459543 CACCTCCCTGGCCATTGCGTGGG + Intergenic
1133677946 16:8093161-8093183 CACCTTCCCAGCCAATCTCTGGG + Intergenic
1134549212 16:15131529-15131551 CTCCTCGCCCGCCAGTGTCAGGG + Intronic
1137397315 16:48125308-48125330 CACCTCCTCTGCCATTGGGTGGG - Intronic
1141585186 16:85028617-85028639 CCCCACCCCCGCCCTTGTCCTGG + Intronic
1145262832 17:21365057-21365079 CCCCACCCCCAGCATTGTCTGGG - Intergenic
1147741102 17:42671348-42671370 CACCTCCCCCGCCGTGGTGTGGG + Exonic
1149660404 17:58331686-58331708 CAGCTCCCCTGCCAAGGTCTTGG + Intergenic
1151325169 17:73375353-73375375 CACCTCCCACCCCGTTGGCTGGG + Intronic
1152687308 17:81700923-81700945 CTCCTCCCCCTCCACTCTCTGGG + Intronic
1153380101 18:4428597-4428619 CACCTCCCCCGTCTCTCTCTTGG + Intronic
1157447092 18:47754207-47754229 CCCCAGCCCTGCCATTGTCTCGG + Intergenic
1160930341 19:1567223-1567245 CCCCGCCGCCGCCTTTGTCTGGG - Intronic
1161677878 19:5662928-5662950 CACCACCCCCGGCCTTGTCCTGG + Intronic
1163293960 19:16400046-16400068 CACCTCACCCGCCAAAGTCAGGG - Intronic
1163867134 19:19782919-19782941 CACCGCCCCCTCCAGAGTCTTGG - Intergenic
1166282882 19:41806973-41806995 CACCGCACCCGGCCTTGTCTTGG + Intronic
1166695562 19:44849493-44849515 CAGCTCCCCCGCCCCTGCCTGGG + Intronic
1168182008 19:54667714-54667736 CTCCTCCCTCCCCACTGTCTGGG + Exonic
1168241412 19:55090983-55091005 CCCCTCCCCGCCCACTGTCTGGG - Exonic
1168254851 19:55159676-55159698 CCCCTCCTCCCTCATTGTCTGGG - Intronic
929993662 2:46811637-46811659 CACCTCCCACCCCCTTGTCAAGG + Intergenic
931524124 2:63133828-63133850 CTCCTCCCCAGCCGTTGTCTTGG - Intronic
932107036 2:68953340-68953362 GGCCTCCCCAGCCACTGTCTTGG - Intergenic
935178190 2:100667850-100667872 CCCATCCCCCTCCACTGTCTTGG + Intergenic
937130697 2:119510280-119510302 CCCCTCCCCCCACATTATCTTGG - Intronic
938703117 2:133897078-133897100 CGCCACCCCCTCCAGTGTCTTGG + Intergenic
939014513 2:136886407-136886429 CACCTCCACTGCCATGGCCTTGG - Intronic
941771193 2:169348076-169348098 TACCTCACCTGTCATTGTCTTGG + Intronic
946036056 2:216743191-216743213 CACCTCCCCCTCCTTTTCCTTGG - Intergenic
947499346 2:230660652-230660674 CACCTCCCGTGCCCTGGTCTGGG + Intergenic
947977502 2:234379703-234379725 CACCCCACCCCCCAATGTCTTGG + Intergenic
949059850 2:241950525-241950547 CATCTCCCCTGCCATCCTCTGGG + Intergenic
1168758714 20:333923-333945 CACACCCCACTCCATTGTCTGGG - Intergenic
1170843263 20:19940894-19940916 AACCTCCCCAGCTATTGTCTGGG + Intronic
1171206080 20:23282625-23282647 CACCTCCCCCTCCTGTTTCTGGG - Intergenic
1173210451 20:41028313-41028335 CCCCTCCCCAGCCTTTGTCCAGG - Intergenic
1175189320 20:57200400-57200422 CACCTACTCCCCCATTGTCCAGG - Intronic
1176180420 20:63747142-63747164 CGCCTCCGCCGCCATGGTCCAGG + Exonic
1177601260 21:23317995-23318017 CCCATCCCACGGCATTGTCTAGG + Intergenic
1178922407 21:36747518-36747540 GCCCTCCCCCGCCTTAGTCTAGG - Intronic
1179081905 21:38179161-38179183 GATCTCTCCTGCCATTGTCTTGG + Intronic
1179370501 21:40802156-40802178 CAACTCCCACCCCAGTGTCTCGG + Intronic
1179928762 21:44552760-44552782 CACCTGCCTCGCCATTGTGATGG + Intronic
1180839992 22:18954765-18954787 CACCTGCCCAGCCACTGGCTTGG + Intergenic
1180852471 22:19028484-19028506 CCCCACCCCCGCCATTTTCCTGG - Intergenic
1181061908 22:20285715-20285737 CACCTGCCCAGCCACTGGCTTGG - Intergenic
1181275714 22:21686518-21686540 CACCTCCACCGCGATGGTCCCGG + Exonic
1182020675 22:27079086-27079108 CACCTCCCCTGCCATCCTGTGGG + Intergenic
1182279722 22:29210794-29210816 CACCTCTCCCGGCCTAGTCTGGG + Intronic
1182896263 22:33861785-33861807 CACCTTCCCTGCCCTTTTCTAGG - Intronic
1184580577 22:45413894-45413916 CAGCGCCACCGCCATGGTCTGGG - Exonic
952274786 3:31866608-31866630 CTCCTCCCCCGCCTTTGTCATGG - Intronic
952275024 3:31868434-31868456 CACCTCCCCCGCCATTGTCTAGG + Intronic
960971585 3:123143683-123143705 CACCTCTGCTGCCATTATCTAGG - Intronic
962630269 3:137268954-137268976 CACCTCCTCCTCCTTTCTCTGGG + Intergenic
962809089 3:138946602-138946624 CACCCCCACCGCCCTTGCCTGGG + Exonic
965738504 3:171848082-171848104 CAACTTCCCTGTCATTGTCTTGG + Intronic
968809206 4:2792618-2792640 CACCTCCCCTGCTCCTGTCTTGG + Intergenic
973573602 4:52264483-52264505 CTCATCCCCTGCCAATGTCTTGG + Intergenic
978885601 4:113762486-113762508 CACCTCCCCCGCTGTTTTCCAGG + Intergenic
980791968 4:137632079-137632101 CTCCTCCCCTGCCAGTGTGTGGG + Intergenic
980816813 4:137958435-137958457 TACCTCCCCCGCCTTTTTTTAGG - Intergenic
982341467 4:154303538-154303560 TACCTCCCCCATCATGGTCTGGG - Intronic
986640871 5:9870733-9870755 CATCTCCTCCTCCATTTTCTGGG - Intergenic
986928959 5:12794924-12794946 CACCGCCGCCGCCATTTTCGTGG + Intergenic
991958666 5:72020475-72020497 CACCTCCAATGCCATTGTCCAGG + Intergenic
992033142 5:72744069-72744091 CATCTCCACTGCCATTGGCTTGG - Intergenic
997093685 5:130886388-130886410 CTCCTCCCCCTCCCTTTTCTGGG + Intergenic
998359662 5:141573909-141573931 CTCCACCCCCTCCTTTGTCTGGG - Exonic
1002385493 5:178862687-178862709 CAGCTCCCACTCCACTGTCTTGG - Intronic
1005953063 6:30645720-30645742 AACTTCCCCCGCCCTTTTCTGGG + Intronic
1011634979 6:89363169-89363191 CATCTCCTCTGCCATTATCTTGG - Intergenic
1015035524 6:128649606-128649628 CACCTCCTCCTTCTTTGTCTTGG + Intergenic
1017099878 6:150838960-150838982 GCCCTCCACTGCCATTGTCTGGG - Intronic
1017218829 6:151942166-151942188 CACCTGACCAGCCATTGTCCTGG - Intronic
1017339265 6:153301863-153301885 CAACTCCCCTGACAGTGTCTAGG + Intergenic
1019633586 7:2063741-2063763 CACCACACCCGCCTTTGTCATGG + Intronic
1020999621 7:15312525-15312547 CACCGCCCCCGCCATGCACTGGG - Intronic
1022096970 7:27147273-27147295 CCCCTCTCCCTCCACTGTCTTGG + Intronic
1023385984 7:39658285-39658307 CACCTCCCCCTACAAAGTCTGGG + Intronic
1025020208 7:55474663-55474685 CATCTGCCCCGCCCTTGTCCTGG - Intronic
1026233701 7:68508121-68508143 CTCCTCCACCTTCATTGTCTAGG - Intergenic
1027048612 7:75007572-75007594 CATCTCCCCTCCCATTGACTTGG - Intronic
1029384398 7:100234077-100234099 CATCTCCCCTCCCATTGTCTTGG + Intronic
1031680465 7:124667268-124667290 CCCTCCCCCCGCCATTTTCTGGG + Intergenic
1035036355 7:155897788-155897810 CACCTGCCCCACCATGGACTGGG + Intergenic
1037898763 8:22675529-22675551 CACCTGCCCTGCCGGTGTCTGGG - Intergenic
1037905566 8:22714123-22714145 CAGCTCCCCCGCCAGGGTCCAGG - Intronic
1041098512 8:54373411-54373433 CACCTCCCGCGCCCTGGGCTGGG - Intergenic
1042786227 8:72550016-72550038 CACCTCACCAGCCATTTGCTAGG + Intronic
1043520523 8:81040374-81040396 CACCTCCACCTCCATTGTGGTGG + Intronic
1043665006 8:82799366-82799388 CACCTCCTCCACCTGTGTCTCGG - Intergenic
1047499729 8:125431610-125431632 CCCCTCCCCCGCCAATGTCCTGG + Intronic
1047815754 8:128460475-128460497 CACCTCCCCCAGAGTTGTCTAGG - Intergenic
1052046329 9:23798427-23798449 CCCCACCCCCGCCATTTTATAGG - Intronic
1053014299 9:34653384-34653406 CACCTCCCCCTCCATTCTTTGGG - Intronic
1058761443 9:108137466-108137488 CACCTCATAAGCCATTGTCTGGG - Intergenic
1059775318 9:117468970-117468992 CCCCTCCTCCCCCATTGTATTGG + Intergenic
1060699080 9:125735072-125735094 CACCTCCCCCGTCTCTCTCTTGG - Intergenic
1061394349 9:130335527-130335549 CAAATCCCCAGCCAATGTCTGGG - Intronic
1061764531 9:132873417-132873439 CACCTCCCTCCCCACTGTCAGGG - Intronic
1062153263 9:135032326-135032348 CTCCTCCCCCGCCCTGGTCGGGG + Intergenic
1185641973 X:1593382-1593404 CACCTCCCCCGCCAATGAGGAGG - Intronic
1186684708 X:11913374-11913396 CACCTCACCCCAGATTGTCTGGG + Intergenic
1191890312 X:65932585-65932607 CCCCTCCCCCTCCCTTGTCCAGG - Intergenic
1194841029 X:98742371-98742393 CATTTCCACCACCATTGTCTTGG + Intergenic
1197753477 X:129980633-129980655 CACCCACCCCGCCCTTGCCTGGG - Intergenic
1199054992 X:143283266-143283288 CACCTCCTCCCCCATCATCTAGG - Intergenic
1199593011 X:149485361-149485383 CACTTCGCCTGCCACTGTCTTGG - Intronic
1199601140 X:149541690-149541712 CACTTCCCCTCCCATTGTCACGG - Exonic
1200042689 X:153381240-153381262 CCCATCACCTGCCATTGTCTGGG + Intergenic
1200257883 X:154594571-154594593 CCTCTCTGCCGCCATTGTCTTGG - Intergenic