ID: 952275026

View in Genome Browser
Species Human (GRCh38)
Location 3:31868437-31868459
Sequence CTCCCCCGCCATTGTCTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 72}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952275021_952275026 6 Left 952275021 3:31868408-31868430 CCATCGGGTTTTGAAGCACCACA 0: 1
1: 0
2: 0
3: 13
4: 51
Right 952275026 3:31868437-31868459 CTCCCCCGCCATTGTCTAGGTGG 0: 1
1: 0
2: 0
3: 13
4: 72
952275019_952275026 14 Left 952275019 3:31868400-31868422 CCCGAGCTCCATCGGGTTTTGAA 0: 1
1: 0
2: 0
3: 1
4: 63
Right 952275026 3:31868437-31868459 CTCCCCCGCCATTGTCTAGGTGG 0: 1
1: 0
2: 0
3: 13
4: 72
952275020_952275026 13 Left 952275020 3:31868401-31868423 CCGAGCTCCATCGGGTTTTGAAG 0: 1
1: 0
2: 0
3: 1
4: 67
Right 952275026 3:31868437-31868459 CTCCCCCGCCATTGTCTAGGTGG 0: 1
1: 0
2: 0
3: 13
4: 72
952275015_952275026 28 Left 952275015 3:31868386-31868408 CCAAAAAGGCAATCCCCGAGCTC 0: 1
1: 0
2: 0
3: 8
4: 73
Right 952275026 3:31868437-31868459 CTCCCCCGCCATTGTCTAGGTGG 0: 1
1: 0
2: 0
3: 13
4: 72
952275018_952275026 15 Left 952275018 3:31868399-31868421 CCCCGAGCTCCATCGGGTTTTGA 0: 1
1: 0
2: 0
3: 3
4: 31
Right 952275026 3:31868437-31868459 CTCCCCCGCCATTGTCTAGGTGG 0: 1
1: 0
2: 0
3: 13
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952275026 Original CRISPR CTCCCCCGCCATTGTCTAGG TGG Intronic
904752748 1:32751110-32751132 CTTCCCCACCATTTTCTAAGAGG + Intronic
906117266 1:43365185-43365207 CTCCCTCTACATTGTCTATGAGG - Exonic
1065567045 10:27022257-27022279 CTCACCCTCCATCCTCTAGGAGG - Intronic
1069703450 10:70442161-70442183 CTCCCTGGCCACTGTCTAGATGG + Intronic
1075424324 10:122329627-122329649 CTCCCCCGGCAGTGGCTGGGGGG - Intronic
1076738428 10:132468810-132468832 CACCCCCACCACTGTCCAGGAGG - Intergenic
1079841696 11:25409358-25409380 CTCCTCTTCTATTGTCTAGGAGG - Intergenic
1083893222 11:65607226-65607248 GTCCCCCGCCATTGGCTGCGGGG - Intronic
1083896071 11:65620449-65620471 CTCCCAAGCCATTGTCTTGGTGG + Intronic
1089763722 11:120748114-120748136 CTCCCCAGCCAAGGTCTTGGTGG - Intronic
1090728681 11:129551110-129551132 CTCTCCTGCCTTTGTGTAGGAGG + Intergenic
1092003052 12:5046954-5046976 TTCACCCACCATTGTCTATGAGG - Intergenic
1104604280 12:130176565-130176587 CACCCCAGCCATTGCCAAGGTGG - Intergenic
1104607644 12:130201802-130201824 GTCCCCCACCATTGTCTCGATGG + Intergenic
1110963003 13:81654331-81654353 CTCCCTTGACATTGTATAGGAGG + Intergenic
1114063155 14:19038127-19038149 CTCCTGGGCCATAGTCTAGGGGG + Intergenic
1114099103 14:19361868-19361890 CTCCCGGGCCATAGTCTAGGGGG - Intergenic
1119323533 14:73745380-73745402 GTCCCTGGCCACTGTCTAGGTGG - Intronic
1123041744 14:105493065-105493087 CTCCCCCTCCAGTGCCCAGGAGG - Intronic
1123493395 15:20800056-20800078 CTCCCGTGCCATAGTCTAGGGGG - Intergenic
1123549904 15:21369158-21369180 CTCCCGTGCCATAGTCTAGGGGG - Intergenic
1129719987 15:77872688-77872710 CACCCCAGCCAGTGTCCAGGAGG + Intergenic
1130894582 15:88160195-88160217 CGCCCCAGCCATGGTCAAGGGGG + Intronic
1132191622 15:99867206-99867228 CTCCACCGCCATTCTCTATCTGG - Intergenic
1202958233 15_KI270727v1_random:96376-96398 CTCCCGTGCCATAGTCTAGGGGG - Intergenic
1133855131 16:9542546-9542568 CTCCCCCTCCATTCTCAACGGGG - Intergenic
1139021291 16:62753104-62753126 CTCCCCCAGCATTGTCCAGAGGG + Intergenic
1144668990 17:17120925-17120947 CTCCCCTGCCTCTGCCTAGGGGG - Intronic
1147419549 17:40315579-40315601 CTCCCGCACCATGGTCTTGGAGG + Intronic
1151658106 17:75504971-75504993 CCCCCCGGGCATTGTCGAGGTGG - Exonic
1152654280 17:81512812-81512834 CTCCCCCGCCGTTATTTAAGCGG + Intronic
1154450947 18:14474594-14474616 CTCCCGTGCCATAGTCTAGGGGG - Intergenic
1160716395 19:578688-578710 CTCCCGTGCCCTTCTCTAGGAGG - Intronic
1160905268 19:1449063-1449085 CTCCCTTGCCTTTGTCTACGGGG + Intronic
1160920708 19:1518948-1518970 CTCCACTGACATTGTCCAGGTGG - Intergenic
1164853681 19:31504305-31504327 CTCCACCTCCACTGTCCAGGAGG - Intergenic
929593764 2:43162972-43162994 CTCCCGAGGCATTGTCTAGAGGG + Intergenic
929993664 2:46811640-46811662 CTCCCACCCCCTTGTCAAGGAGG + Intergenic
932716309 2:74102447-74102469 GTCCCCCCCCCTTGTCTGGGGGG + Exonic
938480503 2:131658289-131658311 CTCCCATGCCATAGTCTAGGGGG + Intergenic
945470034 2:210217969-210217991 CTCCGCAGCTATTGTCTGGGAGG - Exonic
1172768339 20:37362948-37362970 CTCCCTCGCCTTTCTCTAAGCGG + Intronic
1176445290 21:6815979-6816001 CTCCCGTGCCATAGTCTAGGGGG + Intergenic
1176823457 21:13681012-13681034 CTCCCGTGCCATAGTCTAGGGGG + Intergenic
1179370502 21:40802159-40802181 CTCCCACCCCAGTGTCTCGGAGG + Intronic
1180481647 22:15760756-15760778 CTCCCGGGCCATAGTCTAGGGGG + Intergenic
1180852468 22:19028481-19028503 CACCCCCGCCATTTTCCTGGTGG - Intergenic
1184663314 22:45975541-45975563 CTGCCCCGCCATTTTACAGGTGG - Intronic
1184927547 22:47653848-47653870 CTCCACCACCACTGTCCAGGCGG - Intergenic
949613552 3:5728954-5728976 CTCCCCCGCCTTTGTAATGGGGG + Intergenic
952275026 3:31868437-31868459 CTCCCCCGCCATTGTCTAGGTGG + Intronic
953344085 3:42160367-42160389 CTTCCCCGCCCTTGTCTCGCAGG - Intronic
956411733 3:68986423-68986445 CTCTCCCACCAAGGTCTAGGAGG + Intronic
959359250 3:105368053-105368075 GTCCCCGTCCATTGTCTGGGCGG + Intronic
959626615 3:108459055-108459077 CTCCCATGCCATTGTCTACAAGG - Intronic
960479167 3:118168190-118168212 CTGCCCCACCATTGTCTATTGGG - Intergenic
963696872 3:148574100-148574122 AAGCCCCGCCATTGTCCAGGAGG - Intergenic
969530439 4:7727429-7727451 CCCCCCCCCCCTTGTCAAGGAGG + Intronic
973907523 4:55546553-55546575 CTACCCCGCCTGTGTCCAGGAGG + Intronic
984602020 4:181738724-181738746 CTCCCCCTCCATAATTTAGGAGG - Intergenic
1001801452 5:174547798-174547820 TTCCCCTGCCACTGACTAGGAGG - Intergenic
1003218298 6:4135404-4135426 CTCCTTCCCTATTGTCTAGGTGG - Intronic
1003963639 6:11232719-11232741 CCGCCCCGCCATTGGCTAGTGGG + Intronic
1007510549 6:42371374-42371396 CTACCCTTCCAGTGTCTAGGAGG + Intronic
1015841288 6:137479923-137479945 CTCCCTCTCCTTTCTCTAGGTGG - Intergenic
1019548706 7:1591592-1591614 CTCCCCTGCCTTTGTCCCGGGGG - Intergenic
1023722746 7:43112978-43113000 CCCCCCCGCCCTTCTCTGGGCGG + Intronic
1026045154 7:66901985-66902007 TTCCCCGGCCATTTTCTAGCCGG + Intergenic
1028762952 7:94515727-94515749 CTCCCCTCCCCTTTTCTAGGGGG - Intronic
1033470807 7:141647326-141647348 CTTCCTCGCCATGGTCTATGAGG + Intronic
1034756422 7:153625289-153625311 CTCCCAAGCCATTTTCTAAGAGG - Intergenic
1036855381 8:12286607-12286629 CTCCCCCACCATCTTCGAGGAGG - Intergenic
1036906180 8:12710092-12710114 CTCCCCCACCATTTTCGGGGAGG - Intergenic
1037728537 8:21504463-21504485 CTACCTAGCCATTTTCTAGGGGG + Intergenic
1037912745 8:22753785-22753807 CTTCCCCGCCCTTGTGTGGGAGG + Intronic
1039366589 8:36934409-36934431 CTCCTCCCCCATTGTCTTGGTGG - Intronic
1046413122 8:113875273-113875295 CTCACCCTCCATCGTCTAGTAGG + Intergenic
1047815752 8:128460472-128460494 CTCCCCCAGAGTTGTCTAGGAGG - Intergenic
1061525770 9:131160832-131160854 CTCCTCCGCCACTATCTAAGGGG + Intronic
1061874338 9:133536360-133536382 CTCCACAGCCCTTCTCTAGGGGG + Intronic
1062271549 9:135712148-135712170 CTGCCCCGGCCTTGTCTAGGGGG + Intronic
1203523905 Un_GL000213v1:68546-68568 CTCCCGTGCCATAGTCTAGGGGG - Intergenic
1194765670 X:97843941-97843963 CCCCCCCCCCATTGTCTTGCCGG + Intergenic
1195885714 X:109635387-109635409 CTCCCCAGCCTTCCTCTAGGTGG - Intronic
1199585429 X:149411466-149411488 CTCCCCCTTCATTGTCTACCAGG + Intergenic
1200042691 X:153381243-153381265 ATCACCTGCCATTGTCTGGGAGG + Intergenic