ID: 952276462

View in Genome Browser
Species Human (GRCh38)
Location 3:31882110-31882132
Sequence CCTTGCCGGGGCCATAAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 46}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952276462_952276472 21 Left 952276462 3:31882110-31882132 CCCTACTTATGGCCCCGGCAAGG 0: 1
1: 0
2: 0
3: 0
4: 46
Right 952276472 3:31882154-31882176 TTAGCACATGACTGCCCGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 47
952276462_952276470 17 Left 952276462 3:31882110-31882132 CCCTACTTATGGCCCCGGCAAGG 0: 1
1: 0
2: 0
3: 0
4: 46
Right 952276470 3:31882150-31882172 CTCATTAGCACATGACTGCCCGG 0: 1
1: 0
2: 1
3: 5
4: 93
952276462_952276471 18 Left 952276462 3:31882110-31882132 CCCTACTTATGGCCCCGGCAAGG 0: 1
1: 0
2: 0
3: 0
4: 46
Right 952276471 3:31882151-31882173 TCATTAGCACATGACTGCCCGGG 0: 1
1: 0
2: 0
3: 7
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952276462 Original CRISPR CCTTGCCGGGGCCATAAGTA GGG (reversed) Intronic
900098314 1:949422-949444 TCTAGCCTGGGCCAAAAGTATGG + Intronic
901058631 1:6461375-6461397 CCTTGCAGAAGCCCTAAGTACGG - Exonic
903641266 1:24862000-24862022 CCTGGCCGCGGCCATCAGTTTGG + Intergenic
904803994 1:33118263-33118285 CCTGGCTGTGGCCATAAGTGAGG + Intronic
1064498377 10:15940064-15940086 CCTTGCAGGGGACATCAGCAAGG + Intergenic
1067457109 10:46426938-46426960 CCTTGCCTGGAGCCTAAGTAGGG + Intergenic
1067630092 10:47957700-47957722 CCTTGCCTGGAGCCTAAGTAGGG - Intergenic
1071295599 10:84217099-84217121 ACTTGCCGGTGCCTTAAGTTTGG - Exonic
1084736549 11:71109072-71109094 CCATGCAGGGGCCAGAAGCAGGG + Intronic
1113955828 13:114099542-114099564 CCCTGCCTGGGACCTAAGTACGG + Intronic
1115521206 14:34234662-34234684 CCTGGCTGGGGCCGTAGGTATGG - Intronic
1122043064 14:99003611-99003633 CCTGCCTGGGGCCATTAGTATGG - Intergenic
1129551418 15:76454077-76454099 TCTAGCCGGTGACATAAGTAGGG - Intronic
1130782926 15:87063913-87063935 CCTTGCCGTGTCCTTAAGGAAGG + Intergenic
1134058471 16:11184560-11184582 CCTTGCCTGTGCCATTAATAGGG + Intergenic
1146643012 17:34555328-34555350 CCCTGCCTGGGACATAAGGAGGG + Intergenic
1148384892 17:47227290-47227312 CTTTGCCCGGCCCATAACTAAGG + Intergenic
1149862816 17:60133309-60133331 CCTTGCTGGAGCCCTAAGCAAGG - Intergenic
1155580920 18:27305397-27305419 CCTTTCTGGGGATATAAGTAGGG + Intergenic
1159967054 18:74605147-74605169 CCTTCCCGGGGCCATTTCTAGGG + Intronic
1161213292 19:3079592-3079614 CCTTGCCAGGCCCAGAAGGAGGG + Intergenic
1163646742 19:18493783-18493805 CCTTTCCCGGGCCATGAGAAAGG - Intronic
1166558771 19:43718605-43718627 CCTTTCCTTGGCCATAAGGATGG - Exonic
937285210 2:120746325-120746347 CCTGGCCGTGGGCATCAGTAAGG + Intronic
944312212 2:198246055-198246077 CCTTGCAGGTGCCATAATTCAGG + Intronic
1171186666 20:23128046-23128068 CCTTGGCTGGGGCCTAAGTAAGG + Intergenic
1173880207 20:46406341-46406363 CCCTGCCGGGGCCTTAGGAAGGG - Intronic
1180981956 22:19882751-19882773 CCTTACTGGGGCCATGTGTAAGG + Intronic
1183648206 22:39138844-39138866 CCTGGCTGGGGCCATAACAACGG + Intronic
952276462 3:31882110-31882132 CCTTGCCGGGGCCATAAGTAGGG - Intronic
955359282 3:58259026-58259048 CCTTGACGAGGCCATGAGAAGGG - Intronic
956518130 3:70073166-70073188 TCTTGCCGTTGCCATTAGTATGG - Intergenic
960457008 3:117884559-117884581 CATTGCAGTGGCCATATGTATGG + Intergenic
969099865 4:4760691-4760713 CCTTGCCAGGGTCATTTGTAAGG - Intergenic
971063765 4:23003709-23003731 CTTTGCCATGGCCATAAGGATGG - Intergenic
983516644 4:168664061-168664083 CCTTCCCAGGGCCTTAAATAAGG - Intronic
987123979 5:14793760-14793782 CCTTGCGGGGGCAGTAAGTGAGG + Intronic
1004236946 6:13882663-13882685 TGTTGCCGGGGCCATCAGAAAGG + Intergenic
1028827649 7:95291834-95291856 CCTTGCCGAGGCTCTAAATATGG - Intronic
1032537592 7:132677848-132677870 CCTGGCCTGGGCCATGAGCAGGG - Intronic
1034860474 7:154590898-154590920 CCTTGTCGAGGCCATCATTATGG - Intronic
1037914963 8:22767599-22767621 CCTTGCCGGGGGTATATGGATGG + Intronic
1039620994 8:38996971-38996993 CCCTGCCGGGGCCCCAAGTCTGG - Exonic
1052778712 9:32758685-32758707 CTTGACTGGGGCCATAAGTATGG + Intergenic
1060316924 9:122520138-122520160 CCTTGCTGGGATCAGAAGTAAGG - Intergenic
1187055470 X:15738155-15738177 CGTGACCGGGGCAATAAGTACGG + Intronic
1200052736 X:153443577-153443599 CCTGGCCCGGGCCACAAGGAAGG + Intergenic