ID: 952278066

View in Genome Browser
Species Human (GRCh38)
Location 3:31896782-31896804
Sequence CTGTGGAAAGGTGCTGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 232}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952278066_952278074 8 Left 952278066 3:31896782-31896804 CCCTACTCAGCACCTTTCCACAG 0: 1
1: 0
2: 0
3: 26
4: 232
Right 952278074 3:31896813-31896835 AGGCAGAGTTAGCAAAGCCTAGG 0: 1
1: 0
2: 2
3: 21
4: 238
952278066_952278075 9 Left 952278066 3:31896782-31896804 CCCTACTCAGCACCTTTCCACAG 0: 1
1: 0
2: 0
3: 26
4: 232
Right 952278075 3:31896814-31896836 GGCAGAGTTAGCAAAGCCTAGGG 0: 1
1: 0
2: 2
3: 10
4: 149
952278066_952278077 23 Left 952278066 3:31896782-31896804 CCCTACTCAGCACCTTTCCACAG 0: 1
1: 0
2: 0
3: 26
4: 232
Right 952278077 3:31896828-31896850 AGCCTAGGGCCAGTCCTTGGAGG 0: 1
1: 0
2: 0
3: 15
4: 166
952278066_952278076 20 Left 952278066 3:31896782-31896804 CCCTACTCAGCACCTTTCCACAG 0: 1
1: 0
2: 0
3: 26
4: 232
Right 952278076 3:31896825-31896847 CAAAGCCTAGGGCCAGTCCTTGG 0: 1
1: 0
2: 0
3: 14
4: 187
952278066_952278081 28 Left 952278066 3:31896782-31896804 CCCTACTCAGCACCTTTCCACAG 0: 1
1: 0
2: 0
3: 26
4: 232
Right 952278081 3:31896833-31896855 AGGGCCAGTCCTTGGAGGGAGGG 0: 1
1: 0
2: 3
3: 31
4: 290
952278066_952278080 27 Left 952278066 3:31896782-31896804 CCCTACTCAGCACCTTTCCACAG 0: 1
1: 0
2: 0
3: 26
4: 232
Right 952278080 3:31896832-31896854 TAGGGCCAGTCCTTGGAGGGAGG 0: 1
1: 0
2: 2
3: 20
4: 160
952278066_952278082 29 Left 952278066 3:31896782-31896804 CCCTACTCAGCACCTTTCCACAG 0: 1
1: 0
2: 0
3: 26
4: 232
Right 952278082 3:31896834-31896856 GGGCCAGTCCTTGGAGGGAGGGG 0: 1
1: 0
2: 4
3: 25
4: 337
952278066_952278078 24 Left 952278066 3:31896782-31896804 CCCTACTCAGCACCTTTCCACAG 0: 1
1: 0
2: 0
3: 26
4: 232
Right 952278078 3:31896829-31896851 GCCTAGGGCCAGTCCTTGGAGGG 0: 1
1: 0
2: 1
3: 19
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952278066 Original CRISPR CTGTGGAAAGGTGCTGAGTA GGG (reversed) Intronic
900776043 1:4586160-4586182 TTGTGGGAGGGTGCTGAGGAAGG + Intergenic
900919757 1:5662746-5662768 CTGTGCAGTGGTGCTGAGTCTGG - Intergenic
901930921 1:12595743-12595765 CTGTGGAGAGGAGCTGGGTTGGG + Intronic
902651086 1:17838088-17838110 CTGTGCAAAGGCGCAGAGGAGGG + Intergenic
903958601 1:27042087-27042109 CTGTGTAAAAGGGCTGAGTGAGG + Intergenic
904538101 1:31214759-31214781 CTGTGCAAAGGTCCTGTGGAGGG + Intronic
905029342 1:34871137-34871159 CTGTGGAAGGGTTTTGAGCAGGG - Intronic
906295877 1:44648859-44648881 CAGTGTAAAGTTCCTGAGTATGG - Intronic
906540689 1:46583528-46583550 CTGTGGAAAGGAGCTCAGACAGG + Intronic
907588031 1:55638974-55638996 CTCTGGAAAAATGCAGAGTATGG - Intergenic
907867488 1:58412212-58412234 CTGAGGAACAGTGCTAAGTAGGG + Intronic
907969050 1:59362680-59362702 CTGTGGGAAGGAGGTAAGTAAGG - Intronic
909203588 1:72725294-72725316 CTGGGGGAAGCTGCTGTGTAGGG - Intergenic
910365914 1:86465387-86465409 TGGTGGAAAGATGCTGAGAATGG + Intergenic
911768713 1:101711711-101711733 ATGTGCAAAGGTCCTGAGAAAGG - Intergenic
912512846 1:110200233-110200255 CTGTGGAAGAGGGATGAGTAAGG - Exonic
912550119 1:110480009-110480031 CGGTGGAAGGGTGCTGAGGAGGG - Intergenic
912963040 1:114213053-114213075 CTGGGGAAAGTTTCTGAGGAAGG + Intergenic
914718776 1:150272336-150272358 CAGTGGAAATGTTCTGAGGAAGG - Exonic
915924013 1:160002492-160002514 CTGTGCAAAGGTCCTGTGTCAGG - Intergenic
917339743 1:173963671-173963693 CAATGGAAATTTGCTGAGTAAGG - Intronic
917484683 1:175444892-175444914 CTGTGCAAAGGCCCTGAGTGGGG + Intronic
917980388 1:180265609-180265631 TTCTGGAAAGGTGCTGACCAAGG + Intronic
919081554 1:192872606-192872628 CTGTGCACAGGTGCTGAGAATGG + Intergenic
920804876 1:209223607-209223629 CTGGGGAATGGAGCTGAGAAAGG - Intergenic
921016771 1:211199081-211199103 CTGTTGAAATGTGCTGACTGTGG - Intergenic
921410977 1:214836130-214836152 CTGTAGAAAGAACCTGAGTAGGG - Intergenic
922375209 1:224957015-224957037 CCGTGGAAAGGTTCTAAGCAAGG + Intronic
922618983 1:226979232-226979254 CTGTGGAGAGGTCCTGCGAACGG + Intronic
924215530 1:241817695-241817717 CTTGGGGAGGGTGCTGAGTAAGG + Intergenic
1063151284 10:3338762-3338784 CTGTGGAAAGTTGTTGTGTCAGG + Intergenic
1063346862 10:5319682-5319704 TTCTGGACAGGTGCTGGGTAGGG + Intergenic
1064324576 10:14337782-14337804 TTGAGGAAAGGTGCTGAGAATGG - Intronic
1065132551 10:22636772-22636794 CTGTGGGAAGGGGCTGCATAAGG - Intronic
1067135513 10:43604174-43604196 CTGTAGGAAGGTGCTGGGCAGGG + Intergenic
1068861869 10:61855661-61855683 CTGAGGAAAGGAGGTGGGTAGGG + Intergenic
1070763839 10:79045071-79045093 CTGTGGGAAGGTGGTGAGGAGGG + Intergenic
1070805243 10:79266969-79266991 CAGTGGAATGGGGCTGAGGAGGG + Intronic
1071139380 10:82489888-82489910 CTGTGGAAAGATGCACAGAAAGG - Intronic
1072632702 10:97157634-97157656 CTGTAGGAAGGTGCTGTGCAGGG - Intronic
1072666862 10:97400039-97400061 CTGTGTAAAAGTGCTGTGTTAGG + Intronic
1073045625 10:100636243-100636265 CTGTTGAAAGATGCTGAGCAAGG - Intergenic
1073609870 10:104932517-104932539 CTGCTGAAAGTTTCTGAGTAAGG - Intronic
1073631481 10:105154270-105154292 CTGTGGTGAGGGGCTGAGGAAGG - Intronic
1075220654 10:120581639-120581661 CTGTGGAAAGGCTCTGAGGTGGG - Intronic
1076787587 10:132758709-132758731 CTATGGGCAGGTGCTGAGGAAGG + Intronic
1079298555 11:19256905-19256927 CTGTGTAAAGGTGCTGCATGAGG - Intergenic
1079446754 11:20564016-20564038 GAGTGGAAAGATGCTGAGTATGG - Intergenic
1081158528 11:39724851-39724873 CTATGGAAAGGAGTTGATTAGGG - Intergenic
1081293527 11:41356440-41356462 CTGTGGTAAGATGGTGATTAGGG - Intronic
1082105330 11:48215345-48215367 CTGCTGAAAGATGCTCAGTAAGG - Intergenic
1084906125 11:72349268-72349290 GTGTGGTAAAGTGCTGACTAGGG - Intronic
1085125563 11:73999916-73999938 CTGTGGCTAGGTGGTTAGTAAGG + Intergenic
1086113345 11:83221747-83221769 CTGTGGAAAGAACCTTAGTATGG + Intronic
1086170536 11:83831353-83831375 CTCTGGAAGGATGTTGAGTATGG - Intronic
1086513093 11:87581827-87581849 CTTTGGATATGTACTGAGTAGGG + Intergenic
1088823801 11:113477022-113477044 CTATGTAGAGGTGCTGAGTTGGG - Intergenic
1090714394 11:129417318-129417340 CTGGGGAATGGAGCTGAGTCAGG - Intronic
1091878992 12:3961001-3961023 GTGTGGAAAAGTGCTCAGGACGG + Intergenic
1096580324 12:52580842-52580864 CTGGGGAAAGGTGTTAAGAAGGG + Intergenic
1099160624 12:79237159-79237181 CTGTTGACAGGTGCTGTGTCTGG + Intronic
1100903216 12:99267247-99267269 CTCTGGAAAGGTGCATTGTATGG - Intronic
1101738308 12:107480316-107480338 CTGTGGAATGCTTTTGAGTAGGG + Intronic
1102253618 12:111404252-111404274 ATGTGCAAAGGTGCTGAGGTGGG - Intergenic
1102792922 12:115662661-115662683 CTGTGGAGTGGTGATGAGTATGG - Intergenic
1103210700 12:119164278-119164300 CTGTGGAAATGTCCTCAGTGTGG + Intergenic
1103705463 12:122868922-122868944 CGGTGGAAAGGTTCTGTGTCTGG - Intronic
1107022453 13:35765745-35765767 CTGTGCAAATGTGCTCAGGATGG - Intergenic
1107023596 13:35777095-35777117 ATTTAGAAAGCTGCTGAGTAGGG - Intronic
1107542346 13:41403014-41403036 CAGTGGTAATGTGCTCAGTAAGG + Intergenic
1107708550 13:43130918-43130940 CTGAGGAAAGAGGCTGAGCAGGG + Intergenic
1108747746 13:53412232-53412254 CTGTGGAAAGTTTTTGAGTAGGG + Intergenic
1113111482 13:106828589-106828611 CTGAGGAAAGGTGCTGTTTGGGG + Intergenic
1114049645 14:18912838-18912860 CTGGGCACAGGTGCTGAGCAAGG + Intergenic
1114112916 14:19489093-19489115 CTGGGCACAGGTGCTGAGCAAGG - Intergenic
1117898335 14:60509724-60509746 CTGTGGACAAGTACCGAGTAAGG + Exonic
1118435572 14:65767931-65767953 CTGTTCACAGGTGCTGAGTGGGG - Intergenic
1118632165 14:67715502-67715524 CTGTGGTGAGGTGCTCAGGATGG - Intronic
1118655018 14:67937755-67937777 CTGTGGTAAGGGGCTGAAGAAGG - Intronic
1119116372 14:72025587-72025609 CTATGGAAAGGCACAGAGTAAGG - Intronic
1119397874 14:74341118-74341140 CTGTAGAAAGAAGGTGAGTAGGG + Intronic
1119621704 14:76136542-76136564 CTGGGGAGAGGGGCTGAGAAGGG + Intergenic
1121211213 14:92209283-92209305 CTGTGAAGAAGTGCTGAATACGG + Intergenic
1121446453 14:93982039-93982061 CTGTGGAGAGGTCCTTACTAAGG - Intergenic
1122034770 14:98939311-98939333 CTGTGGAAAGTGGGTGAATAAGG - Intergenic
1122195648 14:100083030-100083052 CTCTGGGAAGGTGCTGTGTGAGG - Intronic
1122729001 14:103781091-103781113 GTTTGGAAACGGGCTGAGTATGG - Intronic
1123007018 14:105328670-105328692 CAGCAGAAAGGTGCTGAGTGTGG - Intronic
1126040869 15:44589604-44589626 ATGTGCAAAGCTGCTGAGGAGGG - Intronic
1126403413 15:48297849-48297871 CTATGGAAAGGTGCTGGCTTTGG - Intronic
1126676847 15:51166969-51166991 CTGTTTAACGGTGCTGAGTTTGG + Intergenic
1127251700 15:57245416-57245438 CTGTGCAAAGAGGGTGAGTAGGG - Intronic
1127318240 15:57817569-57817591 CAGTGGAAAGGGGCGGATTAAGG - Intergenic
1129319620 15:74767317-74767339 CTGTGCAAAGGTCCTGAGGCAGG + Intergenic
1131706593 15:95002661-95002683 CTGTGGCATGGTGGTGAATAAGG + Intergenic
1131802746 15:96088840-96088862 CTGTGGAGAGGTGTTTAGTTTGG + Intergenic
1133256362 16:4518880-4518902 CTGTGGGAAGGTGCTGGTGAGGG + Intronic
1133319569 16:4904595-4904617 CTGTGCAAAGGTCCTGAGGCAGG + Intronic
1137754944 16:50893798-50893820 CTGTGGAAAGGTGAAGAGAGAGG - Intergenic
1138479196 16:57290589-57290611 CTGTGCAAAGGCCCTGAGTCAGG + Intergenic
1139343403 16:66286658-66286680 CTGAGTAAAGGTGCTGAGGTGGG + Intergenic
1140472938 16:75225174-75225196 CTGGGGGCAGGTGCTGAGGATGG - Intergenic
1142280828 16:89146735-89146757 TTGGGGAAAGGTTCTGGGTAAGG - Intronic
1143924186 17:10355311-10355333 CTGTGAGGAGGAGCTGAGTAGGG + Intronic
1144061600 17:11587760-11587782 TTGTAGAAAGGTGATGAGAATGG - Intergenic
1155911061 18:31504755-31504777 CTGGGGAAAGTATCTGAGTAGGG - Intronic
1157587880 18:48816870-48816892 AAGTGGAAAAGTGCTGAGTCTGG + Intronic
1161680619 19:5678037-5678059 CTGCGGACAGGAGCTGAGGAGGG + Intronic
1161874715 19:6899252-6899274 GTGGGGAGAGGTGCTGTGTATGG + Intronic
1162095967 19:8310080-8310102 CAGTGGGAAGGTGCTGAGGAAGG + Intronic
1163550533 19:17964268-17964290 CTGTGGAGGGGTGCTGGGGATGG + Intronic
1163563045 19:18032206-18032228 CAGGGGAAAGGAGCTGATTAGGG - Intergenic
1163897014 19:20068139-20068161 TTGAGGAAAGGGGCTGGGTAAGG - Intergenic
1164050674 19:21583714-21583736 CTATGGAAAGGTGCTCACGATGG + Intergenic
1165311616 19:35031977-35031999 CTGTGGAGAGGGGCTGAGTGTGG + Intronic
1165764543 19:38342674-38342696 CTGTGCACAGGTGCTGAATCTGG + Intronic
1166325399 19:42047176-42047198 CTGGGGAAGGGGGCTGAGCATGG - Intronic
1167566490 19:50260703-50260725 CTGTGAAAAGATGGTGAGTGGGG + Exonic
926297404 2:11578729-11578751 CTATGTAAAGATGCTGAGTCAGG + Intronic
926335873 2:11862373-11862395 CTGTGGAAAGGTGCCAGGTCAGG + Intergenic
926414052 2:12632036-12632058 GTGTGGCAAGGTGCTCAGTGGGG - Intergenic
926992045 2:18690450-18690472 CTGTAGAAGGGGTCTGAGTAGGG - Intergenic
929005923 2:37392647-37392669 CTGTGCAAAGGTCCTGAGGTAGG - Intergenic
930263591 2:49174426-49174448 CAGGGGAAAGGTGCTGAGAATGG + Intergenic
930749059 2:54915041-54915063 CTGAGGCAAGGTGCTAAGGAAGG + Intronic
931492562 2:62764642-62764664 CTGTGGAAAGCTGAGGAGTGTGG + Intronic
931811984 2:65863093-65863115 CTATGGAAATGTGCTCTGTATGG + Intergenic
932295235 2:70618716-70618738 CAATGGAAAGGTGCTAAGGAGGG + Intronic
933906792 2:86902048-86902070 CTGGGGAAAGGTGATGTGGAAGG + Intergenic
934024684 2:87991586-87991608 CTGGGGAAAGGTGATGTGGAAGG - Intergenic
934553401 2:95275520-95275542 CTGGGGAAAGGTGCTGGGGGAGG + Intronic
934778189 2:96952102-96952124 GTGTGGAAAGGTGAGGAGTGAGG + Intronic
936772948 2:115936960-115936982 CTTTGGAAAGATGCTCAGGAGGG - Intergenic
936792696 2:116168323-116168345 GTGTACAAAGGTGGTGAGTAGGG + Intergenic
937887761 2:126911668-126911690 CTATGGAAAGGCCCTGAGTAGGG - Intergenic
940457734 2:153922667-153922689 CTGGGGGAAGGTGGAGAGTAAGG - Intronic
942075604 2:172354636-172354658 CTGAAGAGAGGGGCTGAGTATGG - Intergenic
942087173 2:172454401-172454423 CTGTGCAAAGGTCCTGAGCCAGG + Intronic
945755413 2:213839875-213839897 CTGTAGAAAGGAGATGAGGAGGG + Intronic
947388588 2:229616950-229616972 CCCTGGAAAGGTCCTGAATATGG + Intronic
1168730916 20:79992-80014 CTGTGGCCAGGGCCTGAGTAGGG + Intergenic
1168962093 20:1876869-1876891 ATGTGCAAAGCTGCTGAGCAGGG - Intergenic
1170286074 20:14710472-14710494 CTGTGGAAAGACGATGAGCATGG + Intronic
1171317249 20:24206052-24206074 CAGTGGAAAGTTGCTCAGCATGG + Intergenic
1171436545 20:25129452-25129474 CTGTGGAAAGTTGCTAGGAAGGG + Intergenic
1172277640 20:33688622-33688644 CTGTGGGAAGGTGCAGGGAAAGG - Intergenic
1172300038 20:33842958-33842980 CTCTGAAAAGCTGCTGAGGACGG - Intronic
1172873004 20:38147423-38147445 CTGTGCAAAGGCCCTGAGAAGGG - Intronic
1173335967 20:42112654-42112676 GTGGGGAAAGGAGCTGAGTGAGG - Intronic
1173352721 20:42260002-42260024 CTATAGCAAGGTGCTGAGCATGG + Intronic
1173854002 20:46238052-46238074 CTGTGGAGAAGGGCTGAGGATGG - Intronic
1175502837 20:59462395-59462417 ACGTGCAAAGGTGCTGAGGAAGG + Intergenic
1176179356 20:63742168-63742190 CTGCGGGAAGGTGCTGAGCACGG + Exonic
1176383195 21:6123972-6123994 CTGGGGAAGGGTCCTGAGGAGGG - Intergenic
1179740272 21:43414267-43414289 CTGGGGAAGGGTCCTGAGGAGGG + Intergenic
1180022264 21:45135929-45135951 CTTTGGAAAGGGGCTGTGCATGG - Intronic
1180468125 22:15635213-15635235 CTGGGCACAGGTGCTGAGCAAGG + Intergenic
1180976788 22:19853172-19853194 CTGTGGAAAGGTGGTGTTTGTGG - Intronic
1181237282 22:21455435-21455457 TTGTGGAAAGGTGATCAGTATGG - Intergenic
1182069937 22:27456360-27456382 ATGGGGAAAGGGGCTGAGTGCGG + Intergenic
1183301346 22:37060616-37060638 CTGGGGAAAGCAGCTGAGGATGG - Intronic
1183324971 22:37186329-37186351 CTGCACAAAGGTGCTGAGCAGGG - Intronic
1185220091 22:49624885-49624907 CTGCGGGGAGGTGCTGAGGAGGG - Exonic
950549535 3:13657881-13657903 CTGTGGAACGGGCTTGAGTAAGG - Intergenic
951026139 3:17832394-17832416 ATGTGGCAAGGAGCTAAGTAAGG + Intronic
951171425 3:19546275-19546297 CCGTGGAGTTGTGCTGAGTATGG - Intergenic
951678441 3:25268640-25268662 CAGTGCAAAGGTGCTGAGGCAGG - Intronic
952278066 3:31896782-31896804 CTGTGGAAAGGTGCTGAGTAGGG - Intronic
952692845 3:36230176-36230198 GTGGGGGAAGGAGCTGAGTACGG + Intergenic
953038586 3:39234834-39234856 CTTTGAAAAGGAGCTGAGAAAGG + Intergenic
953859564 3:46531485-46531507 CAGTGGGAAGGTGATGAGAACGG + Intronic
953917538 3:46930316-46930338 CTGTGGCAGGGTTCTGAGTCAGG + Intronic
954417817 3:50402640-50402662 CTGTGGGATGGGGCTGAGCAGGG - Intronic
954652680 3:52174988-52175010 CTGTGCAAAGGCCCTGAGGAGGG - Intergenic
955479251 3:59372594-59372616 CTATGGGAAGGTGCTGAGTGAGG + Intergenic
955812864 3:62809439-62809461 CTGTGGAAAAGCTCTGAGAAAGG - Intronic
957146936 3:76436118-76436140 CTGTAGGAAGGTGCTGGGCAGGG - Intronic
957268347 3:77996908-77996930 CTTTGGGAAGCTGCTGAGAAAGG - Intergenic
960163033 3:114371110-114371132 CTGTGGAAGGGTGTTAAGTAGGG - Intronic
961062735 3:123845182-123845204 CTGTGGAAAGGGGCTGCACAGGG + Intronic
961756186 3:129128532-129128554 CTGTGGAAAAGGTCTGAGTGAGG - Intronic
962674866 3:137748248-137748270 CTGGGAAAAGGTGAAGAGTAAGG - Intergenic
965859123 3:173125559-173125581 CAGTGCAAAGGTTCTGAGTTGGG - Intronic
966945728 3:184775901-184775923 CTGATGGAAGGTGCTGAGTTTGG - Intergenic
968230231 3:197001483-197001505 CTGTGGATGGGTGCAGAGAAGGG - Intronic
969249561 4:5958115-5958137 CTTTGGGAAGGGGCTGAGGAGGG - Exonic
969578853 4:8052244-8052266 CTGTGGAAGGGACCTGAGTGAGG - Intronic
970236755 4:13966693-13966715 CTGTGGCAAGCTGCTGAGCCAGG + Intergenic
974017792 4:56664777-56664799 CTGGGGAATGGTGGTGAGGAAGG - Intronic
974812151 4:66958321-66958343 CTGTAGAAAGGTAATGAATAAGG - Intergenic
975015300 4:69408902-69408924 TTGTGGAAAGGTGCTGGTTTGGG + Intronic
976167197 4:82268550-82268572 CTGTGGAAAGCTGCAGTGCAGGG + Intergenic
977517882 4:98045064-98045086 CTGTAGGAAGGTGCTGGGCAGGG - Intronic
978405951 4:108378679-108378701 CTGTAAACAGATGCTGAGTAGGG - Intergenic
980405791 4:132353017-132353039 CTGGGGAAAGAGGCTGAGTGGGG + Intergenic
980650333 4:135705857-135705879 CTTCGGAAAGGTTCTGGGTAGGG - Intergenic
981603128 4:146514251-146514273 CTGAGAAAAGGTCCTGAGTAGGG - Intronic
981657110 4:147124432-147124454 CTGTGGAGTGGTGCTGAGAACGG - Intergenic
983885456 4:172975687-172975709 CTGAGGCAAGGGGCTGAGGATGG - Intronic
985586974 5:745525-745547 CTGGGGAACGGTGCTGACTCAGG + Intronic
988934891 5:36071838-36071860 TTGTGGAAAGCTGCTGGGCATGG - Intergenic
989540567 5:42613528-42613550 CTGTGGAAAGCTGCACAGTTGGG + Intronic
990053371 5:51537606-51537628 CTGGGGAAAGGTGCTGACCCAGG - Intergenic
990205698 5:53426597-53426619 CTCTGAAACGGTGCTAAGTAAGG - Intergenic
990809941 5:59712235-59712257 CTATGGAAAGGTAATGAATATGG - Intronic
992490133 5:77234640-77234662 CTATGGAAAGGTACTATGTAGGG - Intronic
994776188 5:104037462-104037484 CTGTGGAAATGTGGTAAGGATGG - Intergenic
996137999 5:119868898-119868920 CTGATGGAAGGTGCTGAGGAGGG + Intergenic
998761132 5:145433553-145433575 CTGTGGAAAGAAGCTGATAAAGG - Intergenic
999483019 5:151966237-151966259 ATGTGCAAAGGTCCTGAGGAAGG + Intergenic
999966997 5:156820495-156820517 CAGTGGAAAGGCGCTGAGGCTGG + Intergenic
1002315780 5:178342143-178342165 CTGCGGAAGGCTGCTGAGTGCGG + Intronic
1002865325 6:1116594-1116616 ATGTGGAAAGATTCTGACTATGG - Intergenic
1005965705 6:30725034-30725056 CAGGGGAAAGGAGCTGAGTGAGG - Exonic
1009803480 6:68572817-68572839 CTGGGGAAAGGGGCTAAGTGTGG + Intergenic
1009822754 6:68825882-68825904 CTGTAGAGAGCTGCTGAGTCTGG - Intronic
1010187035 6:73156819-73156841 CTGTGGAGAGGTGAACAGTACGG + Intronic
1011808809 6:91105388-91105410 CTGTGGAAAGGTTCTCAGTTTGG + Intergenic
1013020993 6:106218094-106218116 CTTTGGTAAGGGGTTGAGTAAGG + Intronic
1013570469 6:111419184-111419206 TTGAGGAAGGGTGATGAGTAAGG - Intronic
1015070944 6:129092158-129092180 CTGTGGTGAGTTGCTGAGGAAGG - Intronic
1017482631 6:154872705-154872727 CCGTGGAAAGGGGTGGAGTAGGG + Intronic
1018640867 6:165902785-165902807 CTGTGGAAGGATGATGAGTGTGG - Intronic
1019302396 7:313125-313147 CAATGGAAAGGAACTGAGTACGG - Intergenic
1020414883 7:7934293-7934315 CTGTGAAAGAATGCTGAGTAGGG - Intronic
1021420367 7:20439911-20439933 CTGTTGAAAGGTGATGAATGTGG - Intergenic
1024303238 7:47904025-47904047 CTGGGCAAAGGTGCTAAGTGAGG - Intronic
1024705078 7:51948129-51948151 ATGTTGAAAGGGGTTGAGTAAGG + Intergenic
1027175894 7:75903247-75903269 CTGTGGAAAGGGGCTGGGCACGG + Intronic
1028980407 7:96962017-96962039 TTGGGAAAAGGTGCTGAATAAGG + Intergenic
1030949466 7:115771246-115771268 CTGAGCATAGGTGCAGAGTAAGG + Intergenic
1031069969 7:117151381-117151403 CTGTGCAAAGGTCCTAAGAAAGG - Intronic
1031973158 7:128078042-128078064 CTGTGGAAAGTGGCTGGGTCTGG + Intronic
1032385702 7:131521842-131521864 CTGTGGGAATGTGGTGGGTATGG - Intronic
1035166064 7:156990596-156990618 CTGTGGACAAGTGCTGAGATAGG + Intergenic
1038953049 8:32436944-32436966 ATGGGGATTGGTGCTGAGTATGG - Intronic
1039897736 8:41728074-41728096 CTGTGGACAGGTGCTGCTTGAGG + Intronic
1040018533 8:42720028-42720050 CTGTGGAAAGGTGCTGGGGCAGG - Intronic
1042161387 8:65899396-65899418 CTGTGCAAAGGAGCTGAGTGAGG - Intergenic
1042390629 8:68229671-68229693 ATGTGGAAACGTGCTGAGCAAGG + Intronic
1043799796 8:84593895-84593917 GGGTGGAAAGGTTCTGAGGAAGG - Intronic
1044004270 8:86922766-86922788 CTGGGTATAGGTGCTGAGAAGGG + Intronic
1047073757 8:121376778-121376800 CTGTGGTATGGTGCTGAGAACGG - Intergenic
1048338431 8:133520474-133520496 CTGTGAAAAGCTGTTGGGTATGG + Intronic
1048488579 8:134870960-134870982 TTGTGCAAAGGTGCTGAGGTGGG + Intergenic
1051476630 9:17516042-17516064 CAGTGCAAAGGTACTGAGTTGGG - Intergenic
1056790852 9:89624442-89624464 TGGTGGAAAGGTGCTGAGCATGG + Intergenic
1056901357 9:90602977-90602999 CTGAGGAAAGGTGCCCAGTGAGG - Intergenic
1059408411 9:114116675-114116697 ATGTGCAAAGGTCCTGAGTTAGG - Intergenic
1185781425 X:2850716-2850738 GGGTCGAAAGGTGCTCAGTAGGG - Intronic
1186091967 X:6059420-6059442 ATGTTGTAAGGTGCTGATTATGG - Intronic
1187286368 X:17907993-17908015 TTGTGGAAGGTTGCAGAGTAGGG - Intergenic
1188506255 X:30888608-30888630 CTGTTGGTAGGTGTTGAGTAAGG - Intronic
1190062575 X:47220563-47220585 CTGCGGAATAGGGCTGAGTAAGG + Intronic
1190417715 X:50197493-50197515 CGGTGGGAAGCTGCTGAGAAGGG - Intronic
1194057517 X:89154395-89154417 CTTTGGAAAAATGCTGGGTAAGG - Intergenic
1198195266 X:134354078-134354100 CTTTGGAAAGGTGCTTAATAAGG - Intergenic
1199726516 X:150588187-150588209 CTCTGGAAAGATGCTGCTTATGG - Intronic
1200024069 X:153240288-153240310 CTGTGGAAGGGTTTTAAGTAGGG - Intergenic