ID: 952285190

View in Genome Browser
Species Human (GRCh38)
Location 3:31961535-31961557
Sequence GTTAATAATGCTAATAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 222}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952285189_952285190 17 Left 952285189 3:31961495-31961517 CCTAAAACTGCTCTATTTAGAGA 0: 1
1: 0
2: 1
3: 14
4: 239
Right 952285190 3:31961535-31961557 GTTAATAATGCTAATAATGCTGG 0: 1
1: 0
2: 0
3: 17
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952285190 Original CRISPR GTTAATAATGCTAATAATGC TGG Intronic
901521610 1:9789114-9789136 GTGAACAATGCTGCTAATGCTGG + Intronic
902126530 1:14217344-14217366 TTTAAAAATGCTACTAATACAGG + Intergenic
903352558 1:22726729-22726751 GTTAATAATGCTCATTTTGCAGG + Intronic
906850551 1:49245175-49245197 GTTAATAATTGTAATAATGATGG - Intronic
907797960 1:57736628-57736650 CTTAAAAATAATAATAATGCAGG - Intronic
907867881 1:58416360-58416382 TATAATAATGCTAATGATGATGG + Intronic
908082189 1:60593033-60593055 ATTAATTATGGAAATAATGCAGG + Intergenic
908708589 1:66990143-66990165 GTTCATAAAGCTTATAATTCAGG - Intergenic
909749461 1:79141027-79141049 GTTATTAATGCTAATGTTGGTGG + Intergenic
913398509 1:118400048-118400070 ATTAGTAATTCCAATAATGCAGG - Intergenic
915801946 1:158802771-158802793 GTAAGTAATGGTAATAATACTGG - Intergenic
915845205 1:159256071-159256093 TTTCAAAATGCTATTAATGCTGG + Intergenic
916269131 1:162921115-162921137 AATAATAATGTTAATAATGATGG - Intergenic
916831660 1:168498550-168498572 GTTAATAAGGCCAATATTGTGGG + Intergenic
917535094 1:175868746-175868768 AATAATAATTATAATAATGCTGG + Intergenic
917788451 1:178484327-178484349 GGTAATAATGCTGAGAATGTGGG - Intergenic
917933635 1:179842292-179842314 GTTAATAAGGCTCAGCATGCTGG - Exonic
918214547 1:182382135-182382157 ATTAATACTACTAATAATGTGGG - Exonic
923898731 1:238302624-238302646 TTTAATTTTACTAATAATGCAGG + Intergenic
1063037130 10:2297443-2297465 ATTAACGATGCTAATAATGAAGG - Intergenic
1070677990 10:78426907-78426929 TTTAATAATTCTTATAATGCAGG + Intergenic
1072041311 10:91609325-91609347 GTTAATAATGGTCCTATTGCAGG - Intergenic
1072714287 10:97738998-97739020 ATTAATTATGCTAATATTGGGGG - Intronic
1074533669 10:114313533-114313555 GTTAAAGATGCTAATAGTCCTGG + Intronic
1075691670 10:124399791-124399813 GTCAATAATAAAAATAATGCTGG - Intronic
1076147016 10:128130830-128130852 GTCAAAATTGCTAATAAGGCCGG - Intergenic
1078278877 11:9879176-9879198 CTCAAAAATGCTAACAATGCTGG + Intronic
1079263332 11:18905427-18905449 TATAATAATAATAATAATGCTGG + Intergenic
1079801046 11:24869446-24869468 GATAATAATAATAATAATGATGG - Intronic
1080229966 11:30009397-30009419 TTTAATAAAGATAATAATGATGG + Intergenic
1083232152 11:61329537-61329559 GTCAATGATGCCAATAATGCCGG + Exonic
1085901930 11:80710432-80710454 GTAAATAATTATAAAAATGCTGG + Intergenic
1086177804 11:83913509-83913531 ATTAATAATAATAATAATGTAGG + Intronic
1086600090 11:88623044-88623066 GTTAATTATGATAATGATGATGG + Intronic
1089746646 11:120622195-120622217 GTTAAAAATAATAATAAGGCCGG - Intronic
1092820719 12:12350842-12350864 GATAATAATGGTGAAAATGCTGG + Intergenic
1094105328 12:26805356-26805378 ATTAATAATGATGATAATGATGG - Intronic
1097640137 12:62171146-62171168 GTTAATAATAATAATAATAATGG - Intronic
1097877810 12:64659649-64659671 GCTAATAATAATAATATTGCTGG + Intronic
1100880501 12:99010731-99010753 AATAATAATAATAATAATGCTGG - Intronic
1102669591 12:114606311-114606333 ATTAATAATGATGATAATGATGG - Intergenic
1103784642 12:123423080-123423102 GTTACTAGTGCCAAAAATGCTGG - Exonic
1104377330 12:128276230-128276252 TTTAATAATACAAATAATGATGG - Intronic
1104743953 12:131198823-131198845 GATGATAATGGTAATAATGATGG - Intergenic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1107055506 13:36099262-36099284 ATTAAGAATCCAAATAATGCTGG - Intronic
1107575437 13:41715242-41715264 CATAATAATGGTAATAATGATGG - Intronic
1108329810 13:49373975-49373997 GCTAATAATGCTAGGAATGCTGG + Intronic
1108719936 13:53120761-53120783 GGTAATAATAATAATAATACAGG - Intergenic
1108741324 13:53341887-53341909 GCTAATAATCCTACTAATGAGGG + Intergenic
1109233867 13:59792024-59792046 ATTGTTCATGCTAATAATGCTGG - Intronic
1109841003 13:67915858-67915880 ATTATTACTGCTAATACTGCAGG - Intergenic
1110787114 13:79542276-79542298 GTCTAAAATGATAATAATGCAGG - Intronic
1110914339 13:81002672-81002694 GTTACTAATGCTTGTAATTCTGG + Intergenic
1111005184 13:82238558-82238580 TTTAATGATGCTCATAATCCAGG - Intergenic
1111557525 13:89900947-89900969 GTTAAGAAAGCTAATTATGGAGG + Intergenic
1115137694 14:30130862-30130884 GATAATAAAGCTAATAGTTCAGG - Intronic
1115749167 14:36471122-36471144 GCTAATAATTTTAATAATGATGG + Intergenic
1116282156 14:42923083-42923105 ATTATTCATGCTAATAATGCAGG - Intergenic
1117763481 14:59057503-59057525 TTTAATACTCCTAATAATGAGGG + Intergenic
1119843553 14:77811228-77811250 AATACTAATGCTAATAATGGAGG + Intronic
1120382298 14:83796176-83796198 GTTGATAATGATAATGATACAGG - Intergenic
1121056514 14:90859754-90859776 GTTAAGAATTCTAATAAGGAAGG + Exonic
1121874007 14:97434500-97434522 GTTGATGATGGTAATAAGGCTGG + Intergenic
1121948169 14:98143223-98143245 ATTTATAAAGCTGATAATGCTGG - Intergenic
1125260626 15:37820810-37820832 TTTAATAATAATAATAATGATGG - Intergenic
1125488279 15:40127482-40127504 GATATTAATGCCAATATTGCAGG + Intergenic
1125708673 15:41765411-41765433 GTGAATGGGGCTAATAATGCAGG - Intronic
1126548314 15:49897901-49897923 GTTACGAATACTAATAATGGTGG + Intronic
1128299408 15:66556202-66556224 GTGAATAATGCTAAAAACACGGG - Intronic
1131854270 15:96576348-96576370 GTTATTAATGTTACTAATGATGG - Intergenic
1135184537 16:20303995-20304017 GGTAATAATGGTAGTAATGATGG + Intergenic
1139109348 16:63869883-63869905 GTTAATAATAATATCAATGCTGG + Intergenic
1139128970 16:64117457-64117479 GTTGATAATGATAACAATGATGG - Intergenic
1139233779 16:65313106-65313128 ATTCATAATGCTAATAATCATGG + Intergenic
1141031206 16:80590516-80590538 GATAATAATAATAATAAAGCTGG + Intergenic
1146102972 17:30003885-30003907 GGTTATAATGCTATTGATGCAGG + Intronic
1146426392 17:32743590-32743612 AATAATAATAATAATAATGCAGG - Intronic
1148575548 17:48708199-48708221 TTTAATCCTTCTAATAATGCGGG - Intergenic
1149352714 17:55807995-55808017 TTTAATAATGATGATAATGATGG + Intronic
1149744444 17:59081971-59081993 AATAATAATAATAATAATGCTGG + Intronic
1151262883 17:72930610-72930632 GTTAATAACTCTAATCAAGCAGG + Intronic
1152131388 17:78478882-78478904 GATAATGATGATAATAATGGTGG - Intronic
1155333586 18:24742507-24742529 GCTAAAAATGCTATCAATGCTGG - Intergenic
1157121328 18:44913970-44913992 AATAATAATAATAATAATGCAGG + Intronic
1159592973 18:70354774-70354796 GTTAATGTTTCTCATAATGCAGG - Intergenic
1161367623 19:3889875-3889897 GCTAATAATAGTAATAACGCTGG - Intronic
1161915489 19:7225106-7225128 GTTAATAATTGGAATAGTGCTGG - Intronic
1165260061 19:34606168-34606190 GTCAATTATGCCAATAAAGCTGG - Intronic
925272498 2:2622596-2622618 GTGGAGAATGTTAATAATGCTGG - Intergenic
925312273 2:2893445-2893467 GTAATCAATGATAATAATGCAGG - Intergenic
925470263 2:4153491-4153513 GCAAATAATGCTAATGATGCAGG + Intergenic
925661313 2:6206084-6206106 GTTTAGAATGTTAATAAGGCAGG - Intergenic
925696036 2:6579995-6580017 GTTAATTATTCTAATATTTCAGG - Intergenic
925816679 2:7758759-7758781 GTAAATATTGCAAATAATGTTGG + Intergenic
927649704 2:24904999-24905021 GTTAATAACTCTAATAATCAGGG - Intronic
928043897 2:27907959-27907981 GTGAATAATGCTATTAATATGGG + Intronic
928787805 2:34911143-34911165 GTTAGTAATTGTAATAAAGCAGG + Intergenic
930898273 2:56471862-56471884 CCTAGTACTGCTAATAATGCTGG - Intergenic
932000149 2:67877553-67877575 TGTAATTATGCTAATCATGCTGG - Intergenic
933014459 2:77106788-77106810 GATAATAATAATAATAATGAGGG + Intronic
933589117 2:84212458-84212480 GTTAAAAAAATTAATAATGCAGG + Intergenic
935768493 2:106393409-106393431 TTTAATAATAATAATAATTCAGG - Intronic
935911608 2:107902519-107902541 TTTAATAATAATAATAATTCAGG + Intergenic
936773497 2:115943750-115943772 GTTAATAATGTGATGAATGCTGG - Intergenic
937809546 2:126184116-126184138 GTTAATAATGATAATAATAATGG - Intergenic
939726256 2:145724893-145724915 CTTAAAAATGGTAATAATGGGGG - Intergenic
939831755 2:147080800-147080822 TTTAATAATGATAATAATAATGG + Intergenic
941441111 2:165538051-165538073 GCTAATAATGCTAAAGATACAGG - Intronic
941926799 2:170903477-170903499 TTTAAAAATGCAAATAAGGCTGG - Intergenic
942897194 2:181071371-181071393 GTTAATACTGCTTTAAATGCTGG + Intronic
948093775 2:235317199-235317221 GTTAAAAATAATAATAATGCAGG + Intergenic
948240169 2:236424715-236424737 GTTAATTATGGTCATCATGCTGG + Intronic
1168850832 20:975847-975869 GATAATAATGCTTATCTTGCAGG + Intronic
1169820300 20:9702864-9702886 GTTAATCTTCCTAATATTGCTGG - Intronic
1170028318 20:11915620-11915642 GGTAATAAGGCAAGTAATGCAGG - Intronic
1172178759 20:32987923-32987945 GTTAATAATGGTAATCATGGTGG + Intronic
1172737567 20:37139168-37139190 AATAATAATGATAATAATTCTGG + Intronic
1174755531 20:53154874-53154896 GTCAATAATGATAATGATGATGG - Intronic
1175568345 20:59998843-59998865 GCTAATAATGCTAATATTGGCGG - Intronic
1176927729 21:14770344-14770366 GTTAATAATGCAAATTATTAAGG + Intergenic
1181300116 22:21873906-21873928 GTGAATAATGCTGATGCTGCTGG - Intergenic
1183579449 22:38715098-38715120 GGAAGTAATTCTAATAATGCAGG - Intronic
949578141 3:5359075-5359097 ATTAATAATGATAATAATAAGGG - Intergenic
949779965 3:7675294-7675316 GTTAATAGTTGTAATAATGATGG - Intronic
952285190 3:31961535-31961557 GTTAATAATGCTAATAATGCTGG + Intronic
954013652 3:47665649-47665671 GATAATAATGCTAATAAGAGAGG + Intronic
955305993 3:57832677-57832699 GATGATAATGCTGATGATGCTGG + Intronic
955935978 3:64102837-64102859 ATTAATAATGGTGATAATGTGGG + Intronic
956939456 3:74140047-74140069 AGTAATAATGGTAACAATGCCGG - Intergenic
957019721 3:75111989-75112011 GTTAGTAAACCAAATAATGCAGG - Intergenic
959366950 3:105472943-105472965 GATAATAATGCTAATAAGGTGGG + Intronic
960332093 3:116373117-116373139 GTGAATAATGCTATTAACGTGGG - Intronic
960489908 3:118303907-118303929 GACAATAATCCTAATAATACAGG + Intergenic
962207952 3:133450650-133450672 GTTTAAAATGGTAAAAATGCTGG + Intronic
964417631 3:156464492-156464514 AATAATAATAATAATAATGCTGG + Intronic
964870288 3:161306346-161306368 GTTAAAAATGCTCATGAGGCTGG + Intergenic
968590123 4:1454093-1454115 GATGATAATGGTAATAATGGTGG - Intergenic
968592929 4:1468494-1468516 GTGAATGATGATAATAATGATGG + Intergenic
969188791 4:5500286-5500308 GATAATAAAACTAATATTGCAGG + Exonic
969967460 4:11011904-11011926 GTCAATAATAATAATAATGTAGG - Intergenic
970245903 4:14062911-14062933 TTTGATATTGCTAATAATTCTGG - Intergenic
970841174 4:20471392-20471414 ATTAATAATGCTAATATTAATGG - Intronic
970848933 4:20578474-20578496 ATTAATATTGATAATAATGAAGG - Intronic
971713619 4:30148646-30148668 GTTCATAATTCTAATAGTGGTGG + Intergenic
972487201 4:39553573-39553595 TTATATAGTGCTAATAATGCCGG + Intronic
972912862 4:43839955-43839977 GTTAATAATTCCAATATAGCTGG - Intergenic
973080705 4:45989283-45989305 TTTAATAATGATAAAAATACAGG - Intergenic
973324325 4:48842880-48842902 GTTAATGATGCTATTAGTGCAGG - Intronic
973658628 4:53078614-53078636 ACTTATAATGCTAATAAGGCAGG + Intronic
973868963 4:55145289-55145311 GTTAATAATGCTAATATCTGTGG + Intergenic
975778148 4:77811617-77811639 GATAATAATGCTTATCTTGCTGG - Intronic
977120819 4:93098817-93098839 GTTTATTATGATAATGATGCAGG + Intronic
977529324 4:98181680-98181702 GTTGATAATGCCAACATTGCTGG + Intergenic
980366769 4:131813590-131813612 TTTAATAATGCCTATTATGCTGG + Intergenic
980900164 4:138897271-138897293 GTTCAATATGCTGATAATGCAGG - Intergenic
981814319 4:148812443-148812465 ATTTAAAATACTAATAATGCCGG + Intergenic
982599919 4:157435834-157435856 AATAATAATAATAATAATGCTGG - Intergenic
982635374 4:157889018-157889040 GGTGATAATACTAATGATGCTGG + Intergenic
983790247 4:171787858-171787880 GATAATGATGATAATAATGTTGG - Intergenic
984970953 4:185189453-185189475 GTTAATAGAACTAATAATACTGG - Intronic
987684821 5:21183396-21183418 ATTCATAATGCTATTACTGCAGG - Intergenic
988173573 5:27691152-27691174 GATAATAATTCCATTAATGCTGG - Intergenic
989325025 5:40182181-40182203 AATAATAATGATAATAATGGTGG + Intergenic
989667935 5:43878333-43878355 GATAATAATGAGAATAATGATGG + Intergenic
989808696 5:45645574-45645596 TTTAATAATGCTTATAATGATGG - Exonic
990771512 5:59251738-59251760 GTTACTATTGTTAATAGTGCTGG - Intronic
993895972 5:93534838-93534860 CCTAATATTGCTAATAATGTAGG - Intergenic
998086866 5:139333407-139333429 GTTAAAAATGCAAATCAGGCCGG - Intergenic
998514781 5:142743069-142743091 GTTATAAATGCAAATAAAGCTGG + Intergenic
999187453 5:149722906-149722928 GTTAATTATGATAAAAATGTAGG - Intergenic
999496511 5:152104211-152104233 GATAATGATGCTAACAATGAAGG + Intergenic
1000169730 5:158690334-158690356 ATAAATAATACTAATAATCCCGG - Intergenic
1003306256 6:4932227-4932249 GTTAATTATCCTCATAATTCTGG + Intronic
1003851078 6:10223345-10223367 TTTGATAATCCTAATAATCCAGG - Intergenic
1005095363 6:22109139-22109161 GTTAGTAATGAAAAGAATGCTGG + Intergenic
1006345806 6:33481458-33481480 ATTATTAATGTGAATAATGCTGG - Intergenic
1009368598 6:62875288-62875310 GATATTAATCCCAATAATGCAGG + Intergenic
1010584049 6:77635965-77635987 GTTAATAATCCCAATAATAAAGG - Intergenic
1010806369 6:80241687-80241709 GTTCAAAATGCTGATAATGTAGG - Intronic
1010813380 6:80326097-80326119 GTTAATAATATTAACAATGGTGG + Intronic
1011754931 6:90488653-90488675 GTTAATGATGCTTAGAATGAGGG - Intergenic
1012319759 6:97828480-97828502 AAATATAATGCTAATAATGCAGG + Intergenic
1013024663 6:106259485-106259507 ATAAATAATGCTAAAAATACTGG + Intronic
1014275782 6:119386935-119386957 ATTAATAAAACTAATAATCCTGG + Intergenic
1015374833 6:132498701-132498723 TTTGGTAATGCTAATAATACTGG - Intronic
1017803278 6:157919120-157919142 TTTAATACTTCTTATAATGCAGG + Intronic
1019373384 7:675645-675667 GTTCATAAAGTTAAAAATGCAGG + Intronic
1020971360 7:14944792-14944814 GTCAATAATGCTAAGACTGATGG + Intronic
1020990983 7:15195825-15195847 ATTAATAATGGTAATGATACAGG - Intergenic
1021860309 7:24899476-24899498 TTTAATAATGATTATAATGATGG - Intronic
1022202663 7:28132631-28132653 CTGAATAATGCTAATGATGAAGG - Intronic
1022419002 7:30202782-30202804 GTTAAAAACACTAAAAATGCAGG + Intergenic
1023326506 7:39064963-39064985 GTTAATATTTCTCACAATGCTGG - Intronic
1023520163 7:41042216-41042238 GTTCATGATACTTATAATGCGGG + Intergenic
1024278734 7:47700373-47700395 GGTTATAATGCTAATGATGGTGG - Intronic
1027423103 7:78036400-78036422 GTAAATAATAATAATAATGATGG + Intronic
1027633570 7:80640565-80640587 GTTTGTAATGCCAAAAATGCTGG - Intronic
1028046018 7:86119866-86119888 TTTAATATTCCTTATAATGCAGG - Intergenic
1029232220 7:99079910-99079932 ATTAATAAAGATAATAGTGCAGG + Intronic
1030815268 7:114028430-114028452 GTTAAAAATGAAAAGAATGCAGG + Intronic
1031119998 7:117711509-117711531 GTTAATAATGAGAATATTGTAGG + Exonic
1031277297 7:119743707-119743729 ATTAATAATGGTAATCATGCTGG - Intergenic
1033379245 7:140797687-140797709 GTTTATAATGGTAATGATCCAGG - Intronic
1033643247 7:143282616-143282638 AATAATAATAATAATAATGCAGG - Intronic
1035035991 7:155894117-155894139 GATAACAATGGTAATAATGATGG - Intergenic
1037241118 8:16778863-16778885 GTTAATATTGCTAATACTTGTGG + Intergenic
1037530712 8:19770058-19770080 GATAATACTGCTCATGATGCAGG - Intergenic
1040922943 8:52643854-52643876 ATGAATAATGCTAACAATGCTGG + Intronic
1041774875 8:61512699-61512721 TTTAATAATCCTAATTATACAGG + Intronic
1042019708 8:64358535-64358557 ACTAATAATGATAATAATGATGG + Intergenic
1042954126 8:74230454-74230476 GTAAACATTGCTAATAAGGCTGG + Intergenic
1043012497 8:74898642-74898664 GTTAATGATGATAATGATGATGG + Intergenic
1043143766 8:76624996-76625018 GCTAATATAGGTAATAATGCAGG - Intergenic
1043155036 8:76768357-76768379 GGTAATAAATGTAATAATGCAGG + Intronic
1044761987 8:95529248-95529270 TTTAATATTGCTTATAATGATGG - Intergenic
1046090293 8:109495656-109495678 AATAATAATTTTAATAATGCAGG + Intronic
1046236469 8:111429686-111429708 GTTAGTATTGCTAATATTACTGG - Intergenic
1046436914 8:114202719-114202741 GTAAATAAACCTAATAATGTGGG + Intergenic
1050565500 9:6877831-6877853 AGTAATAATGCTAATAAAACTGG - Intronic
1051016294 9:12479265-12479287 GTTAATTTTGCTAATAATTTTGG - Intergenic
1052228504 9:26118971-26118993 GTTAATAATGCCATTAATATTGG + Intergenic
1055843124 9:80530390-80530412 ATAAATAATGCTAGGAATGCTGG + Intergenic
1057202588 9:93150614-93150636 AATAATAATGATAATAATGTAGG - Intergenic
1058375676 9:104318310-104318332 CTTAATAATGCTAAGACTGCAGG + Intergenic
1059115233 9:111595266-111595288 GTTAATAATAATAATAATAATGG + Intronic
1060309980 9:122451148-122451170 AATAATAATAATAATAATGCAGG - Intergenic
1186002748 X:5032076-5032098 GATGATAATGATAATAATGATGG - Intergenic
1187204842 X:17171929-17171951 GTTAATAATAATAATGATGGTGG + Intergenic
1187738096 X:22324894-22324916 GGAAATAATGTTAATAATGGAGG - Intergenic
1193085370 X:77444168-77444190 GACAGTGATGCTAATAATGCTGG - Intergenic
1193278406 X:79619296-79619318 TTTAATAATGATTATAATGAAGG + Intergenic
1193443784 X:81575101-81575123 GTGAATAATGCTAAGAAGGTGGG - Intergenic
1193635131 X:83941206-83941228 GTAAATAATGAAACTAATGCAGG - Intergenic
1194306157 X:92251757-92251779 GATAATGATGATAATAATGATGG - Intronic
1197300305 X:124771871-124771893 GTTAAAAATCCTATTAATTCAGG + Intronic
1200181035 X:154150860-154150882 GTTCACAATGCTGATAGTGCTGG - Exonic
1201474971 Y:14370742-14370764 TTTAATAATGTTAATTCTGCTGG + Intergenic
1202035907 Y:20635026-20635048 GTTAATATTGTAAATAATACAGG + Intergenic
1202065584 Y:20936098-20936120 ATTAATAATAATAATAAGGCTGG + Intergenic