ID: 952285976

View in Genome Browser
Species Human (GRCh38)
Location 3:31970171-31970193
Sequence GATCTAACCCTAATTGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 45}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952285976_952285978 -8 Left 952285976 3:31970171-31970193 CCTGCATCAATTAGGGTTAGATC 0: 1
1: 0
2: 0
3: 5
4: 45
Right 952285978 3:31970186-31970208 GTTAGATCTGACTGAGACTCGGG 0: 1
1: 0
2: 0
3: 11
4: 98
952285976_952285979 -7 Left 952285976 3:31970171-31970193 CCTGCATCAATTAGGGTTAGATC 0: 1
1: 0
2: 0
3: 5
4: 45
Right 952285979 3:31970187-31970209 TTAGATCTGACTGAGACTCGGGG 0: 1
1: 0
2: 0
3: 4
4: 102
952285976_952285977 -9 Left 952285976 3:31970171-31970193 CCTGCATCAATTAGGGTTAGATC 0: 1
1: 0
2: 0
3: 5
4: 45
Right 952285977 3:31970185-31970207 GGTTAGATCTGACTGAGACTCGG 0: 1
1: 0
2: 0
3: 9
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952285976 Original CRISPR GATCTAACCCTAATTGATGC AGG (reversed) Intronic
900827509 1:4938676-4938698 GATGTATCCCTAATTTCTGCTGG + Intergenic
918629564 1:186700092-186700114 GATCTAAACCTAATACATTCAGG + Intergenic
919262559 1:195216340-195216362 GAGTAAACACTAATTGATGCAGG + Intergenic
923966503 1:239146490-239146512 CATCAAACACTAATTGATGTAGG + Intergenic
1063077130 10:2728888-2728910 AATCTAACCCTAAGTGAAACTGG + Intergenic
1064834565 10:19511466-19511488 TATATAACCCTAATTGTTGATGG - Intronic
1070671273 10:78379078-78379100 AATCTAATTCTAATTGATGCAGG + Intergenic
1071177334 10:82941548-82941570 TATCTAACAATAATTAATGCTGG + Intronic
1079273906 11:19015575-19015597 GATCTATCCCTTATTGAAACTGG + Intergenic
1088951458 11:114575136-114575158 GTTTTAATCCTAATGGATGCTGG - Intronic
1102664878 12:114563315-114563337 GATCAAACTCTACCTGATGCAGG + Intergenic
1107449724 13:40497519-40497541 GAGTTAAGCCTAATGGATGCCGG - Intergenic
1119657910 14:76430713-76430735 GTTCTATCCCTAATTGCTGCTGG - Intronic
1124982561 15:34579983-34580005 GAAGTAACGCTAATTTATGCAGG + Intronic
1165476004 19:36031429-36031451 GATTTAATCCTAAGTGATCCAGG - Intronic
929558490 2:42940520-42940542 GATCTAATCCTAACTGATACAGG + Intergenic
937558525 2:123191023-123191045 TATCCAACCTTAATTGATTCTGG - Intergenic
941316835 2:164003926-164003948 GATCCACCCCTAGATGATGCTGG - Intergenic
942390830 2:175491483-175491505 GTTCTAAACCTAAATTATGCCGG - Intergenic
943096338 2:183434110-183434132 CACATAACCCAAATTGATGCTGG - Intergenic
944487752 2:200224633-200224655 AATCTAATCTTAATTGATACTGG + Intergenic
947502237 2:230679550-230679572 GATATAACCCTAATTGACTTGGG + Intergenic
1173676091 20:44836919-44836941 CAACTAGCCCTCATTGATGCAGG - Intergenic
1173889731 20:46497080-46497102 GATTGAACTCTAAGTGATGCAGG + Intergenic
952285976 3:31970171-31970193 GATCTAACCCTAATTGATGCAGG - Intronic
958707560 3:97675117-97675139 GATGAAACCAGAATTGATGCAGG - Intronic
960808797 3:121609166-121609188 GATGCAACCCAAATTGATTCTGG + Intronic
968690964 4:1989955-1989977 GACCTAACCCTAACTGAGGAGGG - Intronic
973136949 4:46720944-46720966 GATCTCATCCTAAGTGATGATGG - Intergenic
975084202 4:70317988-70318010 GCTCCTTCCCTAATTGATGCAGG + Intergenic
977373805 4:96173712-96173734 TATCTAACCTTATTTGATGGAGG + Intergenic
978113359 4:104989448-104989470 AATCTAACCGTAAATGATACTGG - Intergenic
978456040 4:108892986-108893008 TATCCCACCCTAATTGGTGCCGG - Intronic
983617482 4:169724333-169724355 GATCTGAACCTGATTGAAGCTGG + Intergenic
986846451 5:11761763-11761785 GATCTAACACTAATTATTTCTGG + Intronic
992080033 5:73227841-73227863 TATCTAGTCCAAATTGATGCAGG - Intergenic
994073503 5:95626764-95626786 CATGTAACCCTAATGGCTGCTGG + Intergenic
994211779 5:97095112-97095134 GATAAAACCCTAATGGATGTGGG - Intronic
1000374203 5:160564402-160564424 GCTCTGACTCTAACTGATGCAGG + Exonic
1000743477 5:164999601-164999623 CTTTTAACCCTAATTGAGGCTGG + Intergenic
1010280320 6:74015726-74015748 GATTTAACCCTAACTGCTGCTGG + Intergenic
1012369567 6:98486703-98486725 AATCTAACCCAAATTGATTTGGG - Intergenic
1014014359 6:116512959-116512981 TATCTTTACCTAATTGATGCAGG + Intronic
1019225304 6:170503423-170503445 GATGTACCCCTCATTGCTGCAGG - Intergenic
1024718694 7:52109781-52109803 GGTCAAACCCTGATGGATGCAGG + Intergenic
1028450322 7:90974904-90974926 GACCTAACCCTATTTCATTCAGG + Intronic
1028895072 7:96031812-96031834 AATCTAACCCAAATTGCTGTAGG + Intronic
1045380752 8:101622450-101622472 GATCTAATTCTAAATGATGGTGG + Intronic
1047077934 8:121425207-121425229 AATATAACATTAATTGATGCAGG + Intergenic
1050882666 9:10722424-10722446 GATCAAACCCTAATTTAAGCAGG + Intergenic
1052642909 9:31192409-31192431 GATCTCACCCTAATGGGAGCAGG - Intergenic