ID: 952286335

View in Genome Browser
Species Human (GRCh38)
Location 3:31973072-31973094
Sequence CACTGATGCGATTTGGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952286335_952286343 17 Left 952286335 3:31973072-31973094 CCTGGCCCCAAATCGCATCAGTG 0: 1
1: 0
2: 1
3: 10
4: 131
Right 952286343 3:31973112-31973134 CAAAAAGCCTCCCACGTTTCCGG 0: 1
1: 0
2: 0
3: 12
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952286335 Original CRISPR CACTGATGCGATTTGGGGCC AGG (reversed) Intronic