ID: 952287217

View in Genome Browser
Species Human (GRCh38)
Location 3:31980964-31980986
Sequence CGTCCGGGGGAGGCGGCCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 256}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952287217_952287227 -1 Left 952287217 3:31980964-31980986 CCTGCGGCCGCCTCCCCCGGACG 0: 1
1: 0
2: 1
3: 21
4: 256
Right 952287227 3:31980986-31981008 GGGCTAGCGGCCACAGAGCCCGG 0: 1
1: 0
2: 2
3: 15
4: 155
952287217_952287230 9 Left 952287217 3:31980964-31980986 CCTGCGGCCGCCTCCCCCGGACG 0: 1
1: 0
2: 1
3: 21
4: 256
Right 952287230 3:31980996-31981018 CCACAGAGCCCGGGCTGCTGCGG 0: 1
1: 0
2: 4
3: 37
4: 427
952287217_952287228 0 Left 952287217 3:31980964-31980986 CCTGCGGCCGCCTCCCCCGGACG 0: 1
1: 0
2: 1
3: 21
4: 256
Right 952287228 3:31980987-31981009 GGCTAGCGGCCACAGAGCCCGGG 0: 1
1: 0
2: 1
3: 10
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952287217 Original CRISPR CGTCCGGGGGAGGCGGCCGC AGG (reversed) Exonic
901332748 1:8423674-8423696 CGCAGGGCGGAGGCGGCCGCGGG + Intronic
903324699 1:22563342-22563364 CGTGCGGCGGCGGTGGCCGCGGG + Intergenic
904384944 1:30135014-30135036 CGGCCAGGGGAGGCGGGTGCGGG + Intergenic
904724886 1:32539692-32539714 CGTCTGGGGGAGGCGCGCCCGGG - Intronic
904782989 1:32964536-32964558 GGCCCGGGCGCGGCGGCCGCGGG + Exonic
904837748 1:33349918-33349940 CCCCCGGCGGAGGCGGCCGCGGG - Intronic
906214496 1:44030953-44030975 CGATCGGGGGCGGCGGGCGCAGG - Intronic
906520898 1:46466455-46466477 AGGCCGGGCGATGCGGCCGCGGG + Intergenic
907278150 1:53328163-53328185 CGTGGGGCGGAGGCGGCAGCGGG - Intergenic
910758879 1:90716901-90716923 CGGCCGGCGGCGGCGGCTGCTGG + Exonic
911027296 1:93448551-93448573 CGGCCGGGGGAGCAGCCCGCGGG + Intronic
912576095 1:110674294-110674316 CGGCCGGCGGATGCGGCCCCCGG + Exonic
914803249 1:150975015-150975037 CGACCTGGGGAGGCGGGTGCGGG + Intergenic
915348284 1:155209050-155209072 CCTCGGGGGAGGGCGGCCGCCGG - Exonic
924436874 1:244049445-244049467 CGCCCGGGGGAGGGGGCCGGCGG + Intronic
1064221103 10:13440608-13440630 CGCCCGCGGGAGGCGGCGGGGGG + Intronic
1064230809 10:13528534-13528556 GGTGCGGGGAAGGCGGCGGCGGG + Intronic
1065099572 10:22320750-22320772 GGCCGGGGGGCGGCGGCCGCGGG + Intronic
1065214827 10:23439370-23439392 GGCCCGGGGGAGGGGGCCGGCGG - Intergenic
1065533637 10:26697772-26697794 CGGCCGGGGGAGCCGGGCCCGGG - Exonic
1068620635 10:59177203-59177225 CGTCCGGGCCAGGCGGGCGAAGG - Intronic
1069024090 10:63521501-63521523 CGTCCGGGGCGGGTGGGCGCAGG - Exonic
1070277173 10:75018290-75018312 AGTCCTGGGGAGGTGGCAGCAGG - Intronic
1070835926 10:79446684-79446706 CGTCAGGCGGAGGCGGAGGCGGG - Intergenic
1070877192 10:79825789-79825811 CGGGCGGGGGAGGGGGCGGCGGG + Intergenic
1071643688 10:87341833-87341855 CGGGCGGGGGAGGGGGCGGCGGG + Intergenic
1071966593 10:90858109-90858131 CGGCCGGAGGCGGCGGCGGCGGG - Intergenic
1076858815 10:133130020-133130042 ACTCCGGGGGTGGCGGCGGCAGG + Exonic
1076891711 10:133288012-133288034 CGTCCCGGTGAGGCGACCGCAGG - Intronic
1077103775 11:833233-833255 CTTCCGCGGGAGGCGGACTCCGG + Intronic
1077217418 11:1400763-1400785 TGTCCGGGGTGGGTGGCCGCAGG - Intronic
1077254114 11:1572885-1572907 CGTCCTGGGGAGCCCGCCCCCGG - Intergenic
1078058816 11:8030726-8030748 GGTCCGGGGGAAGCGGTCCCTGG + Intronic
1080496959 11:32829929-32829951 CGGTCCGGGGAGGCGGCCGACGG - Exonic
1080551352 11:33376271-33376293 GGAACGGGGGTGGCGGCCGCGGG - Intergenic
1080551380 11:33376326-33376348 GGCCCGGGGGAGGGGGCCCCGGG + Intergenic
1083246278 11:61430205-61430227 CGTCCGGGGCGGGCGGCAGCGGG + Intronic
1083648510 11:64186571-64186593 CGTCCCGAGGGGGCGGCTGCGGG + Intronic
1083729094 11:64643352-64643374 CGGCCGGGGGAGGGGGGGGCGGG + Intronic
1083752096 11:64766446-64766468 CGTTCGGTGGTGGCGGCGGCTGG - Intronic
1083773049 11:64878901-64878923 CGTTCGGCGGAGACGGCCTCTGG + Intronic
1083933416 11:65858056-65858078 CGCCTGAGGGAGGCGGCTGCGGG - Intronic
1084582431 11:70032342-70032364 CGTCGGGGAGAGGCGGGTGCAGG + Intergenic
1085445688 11:76599274-76599296 CAGCTGGGGGAGGGGGCCGCAGG - Intergenic
1086064686 11:82733004-82733026 CGTCCCGGGCAGGCGGCGGCGGG - Exonic
1086455483 11:86955547-86955569 CGGCCGGAGGAGGGGGCCGGAGG - Intergenic
1088604250 11:111512909-111512931 CGTCCGGGAGCTGCAGCCGCGGG + Intergenic
1089432650 11:118436556-118436578 CCACCGGGGGCGGCGGCGGCGGG + Exonic
1090473976 11:127003535-127003557 CGTCCGGGGGCGGCGCGCGGGGG + Intergenic
1091915416 12:4269483-4269505 CGCCCCCGGGAGGGGGCCGCTGG - Intergenic
1094564979 12:31590999-31591021 GGCGCGGGGGAAGCGGCCGCGGG + Exonic
1095476221 12:42589689-42589711 TGTCGGGCGGCGGCGGCCGCGGG + Intronic
1095584552 12:43836013-43836035 CGCCCGGCGTAGGCGGCGGCGGG + Intronic
1096983728 12:55743374-55743396 CCCCGGGGGGAGGCGGCCGAGGG + Exonic
1098161035 12:67648637-67648659 CGGCCGGGGGAGCCGGGGGCGGG + Intronic
1098550371 12:71755137-71755159 CGGCCGGCGGCGGCGGCGGCGGG + Exonic
1101466781 12:104957911-104957933 CGGCCCGGAGAGGCGTCCGCAGG + Intronic
1103479268 12:121240742-121240764 CGTGCGGGGGAGCCGGGGGCGGG + Exonic
1103899342 12:124295346-124295368 GGCCCGGGGCAGGCGGCGGCGGG - Intronic
1112091745 13:96090647-96090669 CGGGCGGGGGAGGCGGGCGCCGG - Intergenic
1112291077 13:98143908-98143930 CGGGCCGGGGAGGTGGCCGCTGG + Intronic
1113082333 13:106533256-106533278 CGGGCGGGCGAGGCGGTCGCGGG - Intronic
1117157015 14:52951222-52951244 CGCTCGGGGGAGGGGGCTGCGGG + Intronic
1117253216 14:53955023-53955045 GGTCCGGGTGCGGAGGCCGCGGG + Intronic
1117912584 14:60649247-60649269 AGGCAGGGGGCGGCGGCCGCAGG + Exonic
1118350950 14:64972202-64972224 CGGGCGGGCGAGGCAGCCGCGGG - Intronic
1119325936 14:73759624-73759646 CGGCCCGGAGAGGGGGCCGCGGG - Intronic
1122581955 14:102777035-102777057 GGTGCGGGCGAGGTGGCCGCGGG + Intergenic
1124500770 15:30225193-30225215 GGCCCGGGTGAGGCGGCGGCAGG - Intergenic
1124742800 15:32313474-32313496 GGCCCGGGTGAGGCGGCGGCAGG + Intergenic
1124957191 15:34367208-34367230 CGCCCGGTGCAGGCGGCCGAGGG + Exonic
1127488178 15:59438213-59438235 CGGCTGGGTGCGGCGGCCGCTGG - Exonic
1128067769 15:64775320-64775342 GGTGCGGGGGAGGGGGCGGCGGG + Exonic
1132525085 16:410491-410513 CGTCAGGGGGAGGCCCCCGCTGG - Intronic
1132552831 16:560415-560437 CGTCGGGGGGACGCGGGCGGCGG + Exonic
1132757548 16:1493442-1493464 GGTCCGGGCGAGGCTCCCGCGGG - Exonic
1132760360 16:1505965-1505987 CGTCCTGGGGAGGCCGCCCTGGG - Intronic
1132844232 16:1992570-1992592 CCTCCGGGCGAGGCCGCCGTGGG + Intronic
1132889530 16:2196874-2196896 CGGGCTGGGGACGCGGCCGCCGG + Intergenic
1132906011 16:2283185-2283207 CCTCCGGAGGAGGCGGACACTGG - Exonic
1136220167 16:28823413-28823435 AGGCAGGGGGAGGCGGCCGCTGG - Exonic
1136778872 16:32885197-32885219 CTGCTGGGGGAGGGGGCCGCGGG + Intergenic
1136891746 16:33976321-33976343 CTGCTGGGGGAGGGGGCCGCGGG - Intergenic
1138426027 16:56932471-56932493 CGTCAGCGGGAGGAGGCCACAGG - Intronic
1138619113 16:58197806-58197828 CGTCGGGCGGAGGAGGCAGCGGG + Exonic
1140440643 16:74985027-74985049 CGTCCTGGGGCCGCGGCGGCCGG - Exonic
1141538641 16:84700453-84700475 CGGCCGGGGGAGGCGGCCCGGGG + Intronic
1141720017 16:85750882-85750904 CGTCCCGGGGAAGGGGCGGCGGG + Intronic
1203081286 16_KI270728v1_random:1147286-1147308 CTGCTGGGGGAGGGGGCCGCGGG + Intergenic
1144500900 17:15786338-15786360 CGCCCAGGGGAGGGGGCCTCGGG + Intergenic
1145163062 17:20589000-20589022 CGCCCAGGGGAGGGGGCCTCGGG + Intergenic
1145255121 17:21318177-21318199 CTTGCGGGGGAGGCGGCCAGTGG - Intergenic
1145321485 17:21769778-21769800 CTTGCGGGGGAGGCGGCCAGTGG + Intergenic
1145874589 17:28307238-28307260 GGTCCCGGGAAGGCGGCCTCGGG + Intergenic
1145938029 17:28726389-28726411 AGTCCGCGGGAGCCGGCCGGTGG - Intronic
1146187261 17:30731941-30731963 GGTCCGGGGGAGGCGGCTTCGGG + Intergenic
1146332303 17:31937302-31937324 GGTCCGGGGGAGGCGGCTTCGGG + Exonic
1146938163 17:36825574-36825596 AGGCCGGGGCAGGAGGCCGCTGG - Intergenic
1147264162 17:39225170-39225192 CCTTCTGGGGAGGCGGCCACTGG - Intronic
1147440259 17:40443426-40443448 AGTCCGGGGGAGCCGGTCCCGGG + Intergenic
1147793079 17:43025280-43025302 GGGGCGGGGGAGGCGGCGGCGGG + Exonic
1148440258 17:47708526-47708548 GGGCAGGGGGAGGCAGCCGCGGG + Intronic
1149614758 17:57988317-57988339 CGACTGGGGGCGGCGGCGGCCGG - Intergenic
1149994332 17:61399127-61399149 CTTCCGGTGAAGGCGGGCGCGGG + Intergenic
1149994479 17:61399588-61399610 AGTCCGGCGCAGGCAGCCGCAGG + Intergenic
1150055269 17:62008681-62008703 CCTCGGGGGGAGGGGGCGGCGGG - Intronic
1150239979 17:63623016-63623038 CATCCCGGGGAAGCGGCGGCGGG + Intronic
1150675954 17:67245833-67245855 CGCCCGGAGGAGGAGACCGCGGG - Intronic
1151624908 17:75270728-75270750 CATCCGGGGGATGCAGCGGCGGG - Intronic
1151705487 17:75764922-75764944 CGGCCGGGACAGGCGGCGGCGGG + Intronic
1152214381 17:79024049-79024071 GGCCGGGAGGAGGCGGCCGCTGG + Intronic
1152354249 17:79799007-79799029 CGCCCGTGGGAGGCCGCCGACGG + Intronic
1152639234 17:81442775-81442797 AGTCCGGGGAAGGAGGCCTCGGG - Exonic
1160668468 19:344586-344608 CGGCCGGGGGCGGCCGCCGATGG + Intronic
1160690149 19:457949-457971 GGTCCCGGGGAGGCGGAAGCGGG + Intronic
1160690157 19:457970-457992 GGTCCTGGGGAGGCGGAAGCCGG + Intronic
1160690270 19:458287-458309 GGTCCCGGGGAGGCGGAAGCGGG + Intronic
1160690369 19:458561-458583 GGTCCTGGGGAGGCGGAAGCGGG + Intronic
1160690444 19:458752-458774 GGTCCCGGGGAGGCGGAGGCGGG + Intronic
1160690461 19:458794-458816 GGTCCTGGGGAGGCGGAAGCGGG + Intronic
1160725421 19:616103-616125 GGCCCGGGTGAGGCGGCGGCAGG - Exonic
1160788116 19:911330-911352 GGTACTGGGGAGGCTGCCGCAGG + Intronic
1160838526 19:1136086-1136108 AGTCCCGGGGAGGAGGCCACGGG + Intronic
1160861055 19:1237398-1237420 CTCCTGGGGGAGGCGGCTGCGGG + Intronic
1160882056 19:1325367-1325389 CGGCGGGGGGCGGCGGCCGGGGG + Intergenic
1160960530 19:1718783-1718805 CGGCCGGGGGAGGGGGAGGCTGG - Intergenic
1161194686 19:2979813-2979835 CGGGCGGGGGAGGGGGGCGCGGG + Intronic
1161374714 19:3933514-3933536 GCCCCGGGGGAGGCGGCCCCTGG - Exonic
1161535464 19:4816475-4816497 CGTGCAGGGGTGGCGGCTGCGGG + Exonic
1161703060 19:5805316-5805338 GGGCCGGAGGGGGCGGCCGCGGG - Intergenic
1161752835 19:6110259-6110281 CGTCCGGGTGGTGCGCCCGCGGG - Intronic
1162954501 19:14090780-14090802 CGTGCGGCGGCGGCGGCGGCGGG - Intronic
1163106328 19:15125028-15125050 CCAGCGGGGGCGGCGGCCGCGGG + Exonic
1163243195 19:16076725-16076747 CGCGCGGGGGAGGAGGCTGCGGG - Intronic
1163551171 19:17967155-17967177 GGGCCGGGGGCGGCGGCGGCAGG - Intronic
1163606922 19:18280797-18280819 CGCCTGGGGGTGGCGGCGGCGGG + Exonic
1163824228 19:19514144-19514166 CATCCGGGGAAGGCAGGCGCGGG - Intronic
1164639361 19:29812632-29812654 CGTGGGGGAGGGGCGGCCGCGGG + Intronic
1166304133 19:41928117-41928139 CGTCCTGGGGAGGGGGCACCGGG + Intronic
1166682615 19:44778122-44778144 CGGCCGGCGGAGGCGGCCCCGGG + Exonic
1166869733 19:45864161-45864183 CGTCCTGGGGCTGCGGCCCCCGG + Intronic
1166876648 19:45901870-45901892 GGTCTGGGAGAGGCGGCGGCGGG - Intronic
1167040607 19:47020785-47020807 GGCGCGGGGGAGGCGGCGGCGGG + Intronic
1167352239 19:48982638-48982660 GGTCTGGGGGAGGGGGCAGCTGG - Intronic
1168144916 19:54415528-54415550 CCCCCGGGGGAGGGGGCAGCGGG - Exonic
925068910 2:951018-951040 CGTCCGCGGGAGGCGGCCGGGGG - Exonic
925607517 2:5673627-5673649 GGTCTGGGGGAGGAGGCAGCTGG + Intergenic
925959774 2:9003804-9003826 CGGTCGGGGGCGGCGGGCGCGGG - Exonic
926154987 2:10448573-10448595 GGGCGGGGAGAGGCGGCCGCAGG - Intergenic
926155000 2:10448603-10448625 GGGCGGGGCGAGGCGGCCGCAGG - Intergenic
928186596 2:29115808-29115830 TGCCCACGGGAGGCGGCCGCGGG - Intronic
931253489 2:60552385-60552407 GGGCCGGGGGAGGAGGCGGCCGG - Intronic
931682976 2:64768203-64768225 CGGACGGGGGAGGCAGCCGGGGG - Intergenic
932700095 2:73985793-73985815 TGTCTGAGGGAGGCGGCCTCGGG - Intergenic
934746172 2:96761043-96761065 CGCCAGGAGGAGGCGCCCGCGGG - Exonic
934978498 2:98822470-98822492 CGCGAGGGGCAGGCGGCCGCTGG + Exonic
938018197 2:127885401-127885423 CGGGCGGGGGAGGGGGCGGCGGG + Intronic
938451477 2:131425103-131425125 CGGGCGCGGGAGGCGGGCGCGGG + Intergenic
938451482 2:131425116-131425138 CGGGCGCGGGAGGCGGGCGCGGG + Intergenic
938451487 2:131425129-131425151 CGGGCGCGGGAGGCGGGCGCGGG + Intergenic
938451492 2:131425142-131425164 CGGGCGCGGGAGGCGGGCGCGGG + Intergenic
938451497 2:131425155-131425177 CGGGCGCGGGAGGCGGGCGCGGG + Intergenic
938451502 2:131425168-131425190 CGGGCGCGGGAGGCGGGCGCGGG + Intergenic
938451507 2:131425181-131425203 CGGGCGCGGGAGGCGGGCGCGGG + Intergenic
938451512 2:131425194-131425216 CGGGCGCGGGAGGCGGGCGCGGG + Intergenic
938451517 2:131425207-131425229 CGGGCGCGGGAGGCGGGCGCGGG + Intergenic
938451521 2:131425220-131425242 CGGGCGCGGGAGGCGGGCGCTGG + Intergenic
947629456 2:231642685-231642707 CCTCCGCAGGATGCGGCCGCGGG - Intergenic
948479099 2:238239448-238239470 CGGGCGGGGGCGCCGGCCGCGGG - Intronic
948580811 2:238986286-238986308 CGTGCGGGGGAGGGGTCGGCTGG + Intergenic
948945851 2:241218392-241218414 CGCCAGGTGGAGGGGGCCGCGGG + Intronic
1169065516 20:2692703-2692725 GGCCCGGGGGAGGCGGGGGCGGG - Intergenic
1169914354 20:10672122-10672144 GGGCCGGGGGCGGCCGCCGCAGG - Intronic
1172118639 20:32585224-32585246 CGGCCGGGGGAGGCGGGAGGCGG + Intronic
1173210750 20:41029494-41029516 GGCGCGGGGGAGGCGGCCGGCGG - Intronic
1173820021 20:46013678-46013700 GGGCAGGGGGAGCCGGCCGCAGG + Exonic
1174386620 20:50191349-50191371 TGCCCGGAGGAGGCGGGCGCGGG - Exonic
1174467953 20:50731750-50731772 CGGCCGGAGGAGGCCGTCGCGGG + Exonic
1175151329 20:56937027-56937049 CGTAGGTGGGAGGCGGCCACTGG + Intergenic
1175826275 20:61938181-61938203 CGTCGGGGGCAGGCAGCGGCCGG + Exonic
1175938222 20:62525024-62525046 CAGCCGGGGTAGGAGGCCGCAGG - Intergenic
1176077245 20:63254159-63254181 CGTGCGCGGGGGGCGGCCGCGGG - Intronic
1176157020 20:63627022-63627044 CGGGCGGCGGCGGCGGCCGCGGG + Intronic
1176179444 20:63742525-63742547 GGGGCGGGGCAGGCGGCCGCAGG - Exonic
1179511820 21:41878813-41878835 CGCCCGGCGGCGGGGGCCGCGGG + Exonic
1179674903 21:42974738-42974760 CGGCGGCGGGCGGCGGCCGCGGG - Intronic
1180005617 21:45019147-45019169 CGGCCGGGGGCGGCGGGCGCGGG - Intergenic
1180147836 21:45931055-45931077 CGGCCATGGGAGGCGGCCGTGGG + Intronic
1180193967 21:46182629-46182651 CTCCCGGGGGAGCCGGCCTCAGG + Exonic
1180951426 22:19722279-19722301 CGTCCGGGGTGGGCAGCGGCAGG - Exonic
1181514152 22:23401907-23401929 CGTCGGGGGGTGGCGGAGGCTGG + Intergenic
1182532083 22:30968667-30968689 CTTCGTGGGGAGGCGGCCACGGG - Intergenic
1183201415 22:36387761-36387783 CGCCCCGGGCAGGCGGCGGCGGG - Intronic
1183393852 22:37560705-37560727 CGCCCGGGAGAGGCGCCCCCGGG + Intronic
1184676291 22:46045083-46045105 TGTCCCGGGGTGGCGGGCGCCGG + Intergenic
1185296855 22:50058711-50058733 CGGCGGGGTGAGGAGGCCGCGGG + Intergenic
1185313767 22:50170320-50170342 CCTCCGGCGGGGGCGGCGGCGGG - Intergenic
1185408953 22:50672862-50672884 CGTCCTGGGGAGGCGGGAGGAGG + Intergenic
949260436 3:2098628-2098650 CGGCCGGAGGAGGCGAGCGCTGG - Intergenic
951407251 3:22316114-22316136 CTTCCGGGTGAGGGGGCCACAGG - Intronic
952287217 3:31980964-31980986 CGTCCGGGGGAGGCGGCCGCAGG - Exonic
954706503 3:52483587-52483609 TGTCCGTGGGAGGTGGCCCCAGG + Intronic
959592054 3:108091544-108091566 CGTCCGGAGGAAACGGGCGCTGG - Intergenic
961674301 3:128555496-128555518 CTTCCTGGCGGGGCGGCCGCGGG - Intergenic
965560976 3:170062265-170062287 CGTGCGGCGGAGGCAGCAGCGGG + Intronic
966886562 3:184380476-184380498 CGCCCGGGGGAGGCGCGGGCGGG + Intronic
968090556 3:195895941-195895963 CCTGCGCGGGAGGCGGGCGCTGG - Intronic
968323470 3:197791597-197791619 CGGCCGGGGGAGGCGGATGCGGG + Intronic
968815198 4:2818294-2818316 CGGCCGGGGGACGCGGCCCGGGG + Exonic
969053320 4:4387290-4387312 CGCCCGGGTGCGGCGGCCCCAGG + Intronic
969804981 4:9600440-9600462 CTTCCGGGGGAGCCCGCAGCAGG - Intergenic
977210065 4:94208120-94208142 CGGGCGGGGGAGGCGGACGAAGG + Intronic
982712186 4:158768885-158768907 AGCCCGGGGCGGGCGGCCGCCGG + Intergenic
984814481 4:183823712-183823734 CATCTGGCGGAGGCTGCCGCGGG + Intergenic
986772854 5:10989207-10989229 CGTCTGGGTGAGGGGGCAGCTGG + Intronic
992950365 5:81852004-81852026 CCGCGGCGGGAGGCGGCCGCAGG - Intergenic
997302937 5:132819716-132819738 CGAGCTGGGGAGGCGGCCGCGGG + Intergenic
998095366 5:139393238-139393260 GGTCCTGGAGAGGCGGCCTCGGG - Exonic
998963126 5:147509545-147509567 GGGGCGGGGGAGGCGGGCGCGGG + Exonic
1001563271 5:172683826-172683848 CGTCCGGGGCTGGCGGCGCCCGG + Exonic
1004562057 6:16760813-16760835 CGCAGGGGGGAGGCGGCGGCTGG - Intronic
1007330247 6:41101218-41101240 CCTGCGGGAGAGGCGGCCGTTGG + Intergenic
1007748725 6:44058962-44058984 CACCCGGGGGAGGCAGCAGCAGG - Intergenic
1011448990 6:87473048-87473070 AGTCCGCGGGGGGCGGCGGCGGG + Intronic
1014230337 6:118895161-118895183 CCAGCGGGGGAGGCGGGCGCAGG + Intronic
1015785970 6:136922019-136922041 CGCCCCGGGGCGGCTGCCGCAGG - Intergenic
1015976434 6:138795990-138796012 CGTCCGGGCGCGGCGGCGGGAGG + Intronic
1016936265 6:149451174-149451196 GGACCGGGAGAGGCGGCCCCAGG + Exonic
1017877562 6:158536961-158536983 CGGCCGGCGGAGGCGGCCGTCGG - Intronic
1018679668 6:166253470-166253492 CTCCCTGGGGTGGCGGCCGCCGG - Intergenic
1018990382 6:168669255-168669277 AGTGCGGGGGAGGGGGACGCAGG - Intronic
1019529040 7:1494560-1494582 GGTCCGGGGGAGGCTGCGGCTGG + Intronic
1022207612 7:28179789-28179811 GGGCCGGGGCCGGCGGCCGCGGG - Intronic
1022410378 7:30135108-30135130 CGGCGGCGGGAGGCGGGCGCGGG + Exonic
1025078870 7:55965045-55965067 CGTCCGGGGCCTGCGGCCTCAGG - Intronic
1026899254 7:74028038-74028060 GGCCTGGGGGAGGGGGCCGCGGG - Intronic
1026968508 7:74454469-74454491 CGTCCCGGGCCGGCGCCCGCAGG + Intronic
1028985647 7:97006502-97006524 CGCCTGGGGGAGGGGGCCGGCGG - Intronic
1029640304 7:101816120-101816142 CGCCCGGGGGTGGGGGCTGCGGG + Intronic
1033657295 7:143382318-143382340 CGATCGGGGGAGGGGGCGGCGGG - Exonic
1034414107 7:150955896-150955918 GCTGCGGGGGAGGGGGCCGCTGG - Intronic
1034414656 7:150958165-150958187 CGTCCGGGCCAGGCTGCAGCTGG + Exonic
1035172031 7:157022149-157022171 TGACCGGGGGAGGCTGCCCCGGG - Intergenic
1036210023 8:6834394-6834416 CGTGCAAGGGAGGCTGCCGCAGG - Intronic
1036910626 8:12754871-12754893 CGGCCAGAGGCGGCGGCCGCGGG + Exonic
1039467718 8:37796413-37796435 GCTCCGGTGGAGGCAGCCGCAGG - Intronic
1039608382 8:38901100-38901122 CGCGCGGGGGAGGCGGGGGCGGG - Intergenic
1041686888 8:60652421-60652443 CGTCGGGGGGGAGCGGCGGCTGG + Intergenic
1042561157 8:70072558-70072580 CGTCGGGGGCGGGCGGGCGCGGG - Intergenic
1043502976 8:80874387-80874409 CGGCCGGGAGAGGCGCGCGCGGG - Intronic
1044819322 8:96145153-96145175 GGTCCGGGGGCGGCGGTTGCTGG + Exonic
1045509960 8:102806546-102806568 CCTCCGGGGGAGGCGGGGGCGGG - Intergenic
1049109800 8:140635655-140635677 CGGCGGGCGGAGGCGGCGGCGGG + Intergenic
1049405405 8:142449961-142449983 GGGCCGGGGGCGGCGGCGGCTGG + Exonic
1049462899 8:142738396-142738418 CCTCCGGGGGTGGGGGCGGCTGG - Intergenic
1049585489 8:143430772-143430794 CCTCCCGGGGAGGCGGGCCCAGG - Intergenic
1049620657 8:143597110-143597132 CGTCCGCGGGACGGGGGCGCCGG - Intronic
1050382173 9:5042064-5042086 CGTCCCGGGGATGGGGCCGCCGG - Intronic
1053214335 9:36258249-36258271 AGGCCGGGGGAGGCGGCCCTGGG + Intronic
1055611748 9:78031471-78031493 CGGGCGCGGGAGGCGGGCGCTGG + Intergenic
1057933973 9:99221531-99221553 CGACCAGGTGAGGCGGCCGCGGG - Exonic
1059470936 9:114504718-114504740 CGGCCGGGGCGGGCGGCGGCGGG - Exonic
1060849172 9:126860621-126860643 CTTCCGGGGGCGGGGGGCGCGGG + Intergenic
1060979644 9:127785175-127785197 GGACCGGGGGAGGCGGAGGCGGG + Intergenic
1061110554 9:128566782-128566804 CATCCAGGAGAGGCGGCAGCAGG + Exonic
1061592038 9:131603876-131603898 GGTGCGGGGGAAGCGGCCTCGGG + Intronic
1061828354 9:133275321-133275343 GGGGCGCGGGAGGCGGCCGCGGG + Intergenic
1061843836 9:133375893-133375915 GGGCCGGGGGAGGAGCCCGCAGG + Intronic
1061908200 9:133709404-133709426 TGTGCGTGGGAGGCGGCTGCAGG - Intronic
1061908989 9:133712958-133712980 GCTCTGGGGGAGGCGGGCGCAGG - Intronic
1062291874 9:135799044-135799066 CATCCGAGGGAGGTGGCCACGGG - Intergenic
1062306230 9:135908194-135908216 CTTCCGGGGGATGCGCCGGCGGG - Intergenic
1062364723 9:136203209-136203231 CGGCCGGGGGGCGGGGCCGCGGG + Intronic
1062600600 9:137317174-137317196 CGGGCAGGGGAGGCGGCCCCAGG + Intronic
1185504036 X:619182-619204 AGTGCGGGGGAGGGGGCCCCGGG - Intergenic
1190745817 X:53321201-53321223 CAGCCGGGGGAGGGGGCCGGCGG + Exonic
1191054963 X:56232242-56232264 AGGCTGAGGGAGGCGGCCGCCGG + Intergenic
1198099894 X:133414708-133414730 CGTCCGGCGCAGGGGGCGGCGGG + Intronic
1199772411 X:150983496-150983518 AGGCAGGGGGAGGCGGCGGCAGG - Intronic