ID: 952288674 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:31993966-31993988 |
| Sequence | TTCCCCAGTTGAGGGATCTT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 540 | |||
| Summary | {0: 1, 1: 0, 2: 4, 3: 60, 4: 475} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 952288674_952288677 | 4 | Left | 952288674 | 3:31993966-31993988 | CCAAAGATCCCTCAACTGGGGAA | 0: 1 1: 0 2: 4 3: 60 4: 475 |
||
| Right | 952288677 | 3:31993993-31994015 | TTAAAAATGTAAACCAACTATGG | 0: 1 1: 0 2: 5 3: 41 4: 420 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 952288674 | Original CRISPR | TTCCCCAGTTGAGGGATCTT TGG (reversed) | Intronic | ||