ID: 952288674

View in Genome Browser
Species Human (GRCh38)
Location 3:31993966-31993988
Sequence TTCCCCAGTTGAGGGATCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 540
Summary {0: 1, 1: 0, 2: 4, 3: 60, 4: 475}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952288674_952288677 4 Left 952288674 3:31993966-31993988 CCAAAGATCCCTCAACTGGGGAA 0: 1
1: 0
2: 4
3: 60
4: 475
Right 952288677 3:31993993-31994015 TTAAAAATGTAAACCAACTATGG 0: 1
1: 0
2: 5
3: 41
4: 420

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952288674 Original CRISPR TTCCCCAGTTGAGGGATCTT TGG (reversed) Intronic