ID: 952295685

View in Genome Browser
Species Human (GRCh38)
Location 3:32059940-32059962
Sequence AATATAGGGTTCGAGAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 60}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952295680_952295685 14 Left 952295680 3:32059903-32059925 CCCTGTCTCAAAAGAAAGAAAAA 0: 16
1: 718
2: 15902
3: 23494
4: 46425
Right 952295685 3:32059940-32059962 AATATAGGGTTCGAGAAGCCAGG 0: 1
1: 0
2: 1
3: 2
4: 60
952295679_952295685 19 Left 952295679 3:32059898-32059920 CCAGACCCTGTCTCAAAAGAAAG 0: 3
1: 65
2: 821
3: 2944
4: 5020
Right 952295685 3:32059940-32059962 AATATAGGGTTCGAGAAGCCAGG 0: 1
1: 0
2: 1
3: 2
4: 60
952295681_952295685 13 Left 952295681 3:32059904-32059926 CCTGTCTCAAAAGAAAGAAAAAA 0: 11
1: 569
2: 15166
3: 22015
4: 38149
Right 952295685 3:32059940-32059962 AATATAGGGTTCGAGAAGCCAGG 0: 1
1: 0
2: 1
3: 2
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952295685 Original CRISPR AATATAGGGTTCGAGAAGCC AGG Intronic